Incidental Mutation 'R5685:Stard13'
ID443275
Institutional Source Beutler Lab
Gene Symbol Stard13
Ensembl Gene ENSMUSG00000016128
Gene NameStAR-related lipid transfer (START) domain containing 13
SynonymsGT650, DLC2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5685 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location151037510-151233836 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 151063127 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 188 (I188T)
Ref Sequence ENSEMBL: ENSMUSP00000144056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062015] [ENSMUST00000110483] [ENSMUST00000129088] [ENSMUST00000202111] [ENSMUST00000202365]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062015
AA Change: I306T

PolyPhen 2 Score 0.492 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000053232
Gene: ENSMUSG00000016128
AA Change: I306T

DomainStartEndE-ValueType
Pfam:SAM_2 59 120 2.6e-6 PFAM
low complexity region 197 216 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 612 624 N/A INTRINSIC
RhoGAP 693 884 2.37e-50 SMART
START 927 1129 2.08e-40 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110483
AA Change: I306T

PolyPhen 2 Score 0.492 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106109
Gene: ENSMUSG00000016128
AA Change: I306T

DomainStartEndE-ValueType
PDB:2JW2|A 50 120 1e-37 PDB
low complexity region 197 216 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 612 624 N/A INTRINSIC
RhoGAP 674 865 2.37e-50 SMART
START 908 1110 2.08e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129088
SMART Domains Protein: ENSMUSP00000116705
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
Blast:SAM 40 104 6e-32 BLAST
PDB:2JW2|A 42 104 8e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201680
Predicted Effect possibly damaging
Transcript: ENSMUST00000202111
AA Change: I188T

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144056
Gene: ENSMUSG00000016128
AA Change: I188T

DomainStartEndE-ValueType
low complexity region 79 98 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
low complexity region 494 506 N/A INTRINSIC
RhoGAP 556 747 1.4e-52 SMART
START 790 992 1.4e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202385
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains an N-terminal sterile alpha motif (SAM) for protein-protein interactions, followed by an ATP/GTP-binding motif, a GTPase-activating protein (GAP) domain, and a C-terminal STAR-related lipid transfer (START) domain. It may be involved in regulation of cytoskeletal reorganization, cell proliferation, and cell motility, and acts as a tumor suppressor in hepatoma cells. The gene is located in a region of chromosome 13 that is associated with loss of heterozygosity in hepatocellular carcinomas. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small body size, decreased weight, and reduced adipose tissue. Mice homozygous for another knock-out allele exhibit increased angiogenesis in matrigel plugs and implanted tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,230,550 probably benign Het
4921501E09Rik T A 17: 33,066,772 H352L probably benign Het
Abcb5 A T 12: 118,932,613 probably null Het
Abcg1 G T 17: 31,098,286 E191* probably null Het
Als2 A G 1: 59,179,091 Y1263H possibly damaging Het
Amer2 T A 14: 60,379,577 L281* probably null Het
Anxa6 T C 11: 54,996,370 N361D probably benign Het
Ap1g1 A T 8: 109,837,783 N320I probably damaging Het
Aqr T C 2: 114,156,265 D208G possibly damaging Het
Arnt2 T C 7: 84,263,265 T545A probably benign Het
Aspm G A 1: 139,487,288 V2701I probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Bbs2 A C 8: 94,087,433 F186V probably damaging Het
Catsperg2 G A 7: 29,701,188 P247L probably damaging Het
Cfap57 G T 4: 118,569,459 Q1098K probably benign Het
Cxcr6 A G 9: 123,810,746 T271A probably benign Het
Dock1 A G 7: 134,772,362 E579G probably benign Het
Frem3 A G 8: 80,695,303 T2111A probably damaging Het
Galnt1 A T 18: 24,264,529 D229V possibly damaging Het
Gbp2b A C 3: 142,608,158 M400L probably benign Het
Gm1123 T A 9: 99,009,433 probably null Het
Gtpbp6 T C 5: 110,104,939 H349R probably damaging Het
Hyal5 A G 6: 24,876,692 K188R probably benign Het
Insrr T C 3: 87,800,496 probably null Het
Kcnn1 A T 8: 70,852,730 C322S probably damaging Het
Kdelr1 GTCTA G 7: 45,881,617 probably null Het
Kif23 T C 9: 61,945,409 T8A probably benign Het
Lrrk2 A T 15: 91,803,301 R2198* probably null Het
Mcl1 T G 3: 95,659,798 D177E possibly damaging Het
Mrps11 A T 7: 78,791,880 T137S probably benign Het
Mtbp A G 15: 55,562,772 Y90C probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nxt1 G T 2: 148,675,753 W138L possibly damaging Het
Olfr1042 T C 2: 86,159,795 T192A probably damaging Het
Olfr1102 T A 2: 87,002,277 S103T probably benign Het
Olfr183 T A 16: 59,000,346 F220L probably benign Het
Osbpl7 C A 11: 97,060,277 P478H probably damaging Het
Pitpna T A 11: 75,620,269 F222I probably damaging Het
Plekhh2 A T 17: 84,569,882 R552W probably damaging Het
Plxnb2 C T 15: 89,167,032 R328H probably damaging Het
Pmaip1 C T 18: 66,460,984 T65I probably benign Het
Ppil4 T G 10: 7,798,422 I110S probably damaging Het
Prpf38a A G 4: 108,570,154 probably null Het
Psme4 G A 11: 30,809,837 G320D probably damaging Het
Rab17 C A 1: 90,958,957 R191L probably benign Het
Rhag A T 17: 40,831,331 M222L possibly damaging Het
Rims2 A T 15: 39,437,206 H111L possibly damaging Het
Setx T C 2: 29,171,280 Y2234H probably damaging Het
Slc2a8 T C 2: 32,981,789 I51V possibly damaging Het
Slc34a1 T C 13: 55,401,272 probably null Het
Slf1 T C 13: 77,083,479 T594A possibly damaging Het
Sox6 A T 7: 115,579,157 probably null Het
Spata13 C T 14: 60,691,203 S70L probably benign Het
Stard9 A G 2: 120,705,322 D4020G probably damaging Het
Tdp1 A G 12: 99,902,352 K255R possibly damaging Het
Tns2 G T 15: 102,107,103 A124S probably benign Het
Top2b T A 14: 16,413,666 W1045R probably damaging Het
Trav12-2 T C 14: 53,616,665 V32A probably damaging Het
Vps13c G T 9: 67,963,173 R3198L possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp52 T A 17: 21,561,751 S620R probably benign Het
Zfp62 T A 11: 49,216,217 C378* probably null Het
Zfp638 C A 6: 83,929,987 P378H probably damaging Het
Other mutations in Stard13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Stard13 APN 5 151042239 missense probably damaging 1.00
IGL01362:Stard13 APN 5 151189952 missense probably benign 0.05
IGL01588:Stard13 APN 5 151045237 missense probably damaging 1.00
IGL01947:Stard13 APN 5 151062844 missense probably damaging 1.00
IGL02294:Stard13 APN 5 151063115 missense probably benign 0.19
IGL02713:Stard13 APN 5 151042186 nonsense probably null
IGL02746:Stard13 APN 5 151046857 splice site probably benign
IGL02827:Stard13 APN 5 151063126 missense probably benign 0.07
R0498:Stard13 UTSW 5 151052477 missense probably damaging 1.00
R1427:Stard13 UTSW 5 151045991 missense probably damaging 0.99
R1785:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R1857:Stard13 UTSW 5 151095438 missense probably damaging 1.00
R1858:Stard13 UTSW 5 151095438 missense probably damaging 1.00
R2130:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2131:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2132:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2133:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2258:Stard13 UTSW 5 151039731 missense probably damaging 1.00
R3435:Stard13 UTSW 5 151042179 missense probably damaging 1.00
R4080:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4081:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4082:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4233:Stard13 UTSW 5 151062699 missense probably benign 0.00
R4288:Stard13 UTSW 5 151045177 missense probably damaging 1.00
R4303:Stard13 UTSW 5 151062869 missense possibly damaging 0.82
R4659:Stard13 UTSW 5 151062788 missense probably benign 0.01
R4695:Stard13 UTSW 5 151060815 missense probably benign 0.08
R4910:Stard13 UTSW 5 151062527 missense probably benign
R5135:Stard13 UTSW 5 151062767 nonsense probably null
R5338:Stard13 UTSW 5 151059598 missense probably damaging 1.00
R5399:Stard13 UTSW 5 151047801 nonsense probably null
R5546:Stard13 UTSW 5 151045901 missense probably benign 0.03
R5771:Stard13 UTSW 5 151190011 missense probably damaging 1.00
R6034:Stard13 UTSW 5 151095500 splice site probably null
R6034:Stard13 UTSW 5 151095500 splice site probably null
R6141:Stard13 UTSW 5 151042242 missense probably damaging 1.00
R6171:Stard13 UTSW 5 151092762 missense probably damaging 1.00
R6296:Stard13 UTSW 5 151062673 missense probably damaging 1.00
R6326:Stard13 UTSW 5 151046919 missense possibly damaging 0.95
R6508:Stard13 UTSW 5 151063289 missense probably benign 0.06
R7252:Stard13 UTSW 5 151063169 missense probably benign 0.01
R7318:Stard13 UTSW 5 151062573 nonsense probably null
R7459:Stard13 UTSW 5 151047599 missense probably damaging 1.00
R7571:Stard13 UTSW 5 151059502 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATCTGGTAATGCCGTCCCTG -3'
(R):5'- CAGTCTTTTCACCCCAAGAATG -3'

Sequencing Primer
(F):5'- ATCCAGGTCCTCCAGGTACATG -3'
(R):5'- GTCTTTTCACCCCAAGAATGAGAAAC -3'
Posted On2016-11-09