Incidental Mutation 'R5685:Bbs2'
ID443290
Institutional Source Beutler Lab
Gene Symbol Bbs2
Ensembl Gene ENSMUSG00000031755
Gene NameBardet-Biedl syndrome 2 (human)
Synonyms2410125H22Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R5685 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location94067954-94098928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 94087433 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 186 (F186V)
Ref Sequence ENSEMBL: ENSMUSP00000034206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034206]
Predicted Effect probably damaging
Transcript: ENSMUST00000034206
AA Change: F186V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034206
Gene: ENSMUSG00000031755
AA Change: F186V

DomainStartEndE-ValueType
Pfam:BBS2_N 20 161 1.4e-62 PFAM
Pfam:BBS2_Mid 162 272 6.9e-50 PFAM
Pfam:BBS2_C 276 715 2.6e-193 PFAM
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by severe pigmentary retinopathy, obesity, polydactyly, renal malformation and mental retardation. The proteins encoded by BBS gene family members are structurally diverse and the similar phenotypes exhibited by mutations in BBS gene family members is likely due to their shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene forms a multiprotein BBSome complex with seven other BBS proteins.[provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous null mice display obesity associated with polyphagia, retinopathy associated with mislocalization of rhodopsin, cilia defects, renal cysts, male sterility, abnormal brain neuroanatomy, reduced salivation and acoustic startle response, an olfactory deficit and abnormal social interaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,230,550 probably benign Het
4921501E09Rik T A 17: 33,066,772 H352L probably benign Het
Abcb5 A T 12: 118,932,613 probably null Het
Abcg1 G T 17: 31,098,286 E191* probably null Het
Als2 A G 1: 59,179,091 Y1263H possibly damaging Het
Amer2 T A 14: 60,379,577 L281* probably null Het
Anxa6 T C 11: 54,996,370 N361D probably benign Het
Ap1g1 A T 8: 109,837,783 N320I probably damaging Het
Aqr T C 2: 114,156,265 D208G possibly damaging Het
Arnt2 T C 7: 84,263,265 T545A probably benign Het
Aspm G A 1: 139,487,288 V2701I probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Catsperg2 G A 7: 29,701,188 P247L probably damaging Het
Cfap57 G T 4: 118,569,459 Q1098K probably benign Het
Cxcr6 A G 9: 123,810,746 T271A probably benign Het
Dock1 A G 7: 134,772,362 E579G probably benign Het
Frem3 A G 8: 80,695,303 T2111A probably damaging Het
Galnt1 A T 18: 24,264,529 D229V possibly damaging Het
Gbp2b A C 3: 142,608,158 M400L probably benign Het
Gm1123 T A 9: 99,009,433 probably null Het
Gtpbp6 T C 5: 110,104,939 H349R probably damaging Het
Hyal5 A G 6: 24,876,692 K188R probably benign Het
Insrr T C 3: 87,800,496 probably null Het
Kcnn1 A T 8: 70,852,730 C322S probably damaging Het
Kdelr1 GTCTA G 7: 45,881,617 probably null Het
Kif23 T C 9: 61,945,409 T8A probably benign Het
Lrrk2 A T 15: 91,803,301 R2198* probably null Het
Mcl1 T G 3: 95,659,798 D177E possibly damaging Het
Mrps11 A T 7: 78,791,880 T137S probably benign Het
Mtbp A G 15: 55,562,772 Y90C probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nxt1 G T 2: 148,675,753 W138L possibly damaging Het
Olfr1042 T C 2: 86,159,795 T192A probably damaging Het
Olfr1102 T A 2: 87,002,277 S103T probably benign Het
Olfr183 T A 16: 59,000,346 F220L probably benign Het
Osbpl7 C A 11: 97,060,277 P478H probably damaging Het
Pitpna T A 11: 75,620,269 F222I probably damaging Het
Plekhh2 A T 17: 84,569,882 R552W probably damaging Het
Plxnb2 C T 15: 89,167,032 R328H probably damaging Het
Pmaip1 C T 18: 66,460,984 T65I probably benign Het
Ppil4 T G 10: 7,798,422 I110S probably damaging Het
Prpf38a A G 4: 108,570,154 probably null Het
Psme4 G A 11: 30,809,837 G320D probably damaging Het
Rab17 C A 1: 90,958,957 R191L probably benign Het
Rhag A T 17: 40,831,331 M222L possibly damaging Het
Rims2 A T 15: 39,437,206 H111L possibly damaging Het
Setx T C 2: 29,171,280 Y2234H probably damaging Het
Slc2a8 T C 2: 32,981,789 I51V possibly damaging Het
Slc34a1 T C 13: 55,401,272 probably null Het
Slf1 T C 13: 77,083,479 T594A possibly damaging Het
Sox6 A T 7: 115,579,157 probably null Het
Spata13 C T 14: 60,691,203 S70L probably benign Het
Stard13 A G 5: 151,063,127 I188T possibly damaging Het
Stard9 A G 2: 120,705,322 D4020G probably damaging Het
Tdp1 A G 12: 99,902,352 K255R possibly damaging Het
Tns2 G T 15: 102,107,103 A124S probably benign Het
Top2b T A 14: 16,413,666 W1045R probably damaging Het
Trav12-2 T C 14: 53,616,665 V32A probably damaging Het
Vps13c G T 9: 67,963,173 R3198L possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp52 T A 17: 21,561,751 S620R probably benign Het
Zfp62 T A 11: 49,216,217 C378* probably null Het
Zfp638 C A 6: 83,929,987 P378H probably damaging Het
Other mutations in Bbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Bbs2 APN 8 94089167 critical splice acceptor site probably null
IGL02250:Bbs2 APN 8 94092426 missense probably benign 0.22
IGL02427:Bbs2 APN 8 94081118 missense possibly damaging 0.92
IGL02810:Bbs2 APN 8 94086911 missense probably benign 0.00
IGL02850:Bbs2 APN 8 94077082 missense probably benign
IGL03050:Bbs2 APN 8 94074413 splice site probably benign
IGL03292:Bbs2 APN 8 94075121 critical splice donor site probably null
R0755:Bbs2 UTSW 8 94082080 missense probably benign 0.22
R0835:Bbs2 UTSW 8 94075259 missense probably damaging 1.00
R1404:Bbs2 UTSW 8 94081999 missense probably null 0.01
R1404:Bbs2 UTSW 8 94081999 missense probably null 0.01
R1513:Bbs2 UTSW 8 94089844 missense possibly damaging 0.94
R1972:Bbs2 UTSW 8 94081177 splice site probably benign
R4648:Bbs2 UTSW 8 94080879 missense probably damaging 1.00
R4876:Bbs2 UTSW 8 94070160 unclassified probably benign
R4911:Bbs2 UTSW 8 94089115 missense probably damaging 1.00
R4966:Bbs2 UTSW 8 94080807 missense probably damaging 1.00
R4982:Bbs2 UTSW 8 94082354 critical splice donor site probably null
R5202:Bbs2 UTSW 8 94092414 nonsense probably null
R5347:Bbs2 UTSW 8 94092550 missense probably damaging 0.98
R5364:Bbs2 UTSW 8 94074395 missense probably benign 0.00
R5538:Bbs2 UTSW 8 94089763 missense probably damaging 1.00
R5918:Bbs2 UTSW 8 94098303 missense probably damaging 0.98
R5963:Bbs2 UTSW 8 94081031 missense probably benign 0.02
R5964:Bbs2 UTSW 8 94068367 missense probably benign 0.18
R5991:Bbs2 UTSW 8 94098286 missense probably benign 0.24
R6050:Bbs2 UTSW 8 94092532 missense probably damaging 1.00
R6172:Bbs2 UTSW 8 94087411 missense probably benign 0.02
R6241:Bbs2 UTSW 8 94098235 critical splice donor site probably null
R6578:Bbs2 UTSW 8 94077041 missense probably null 0.00
R7330:Bbs2 UTSW 8 94087405 missense possibly damaging 0.78
R7404:Bbs2 UTSW 8 94082364 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTGAGTGCAATGCTGACCTG -3'
(R):5'- CGTAGAGCCACATTTTCTCAAGTG -3'

Sequencing Primer
(F):5'- GTGCAATGCTGACCTGCCTAC -3'
(R):5'- ATTACAACCCCCTTGAGTACTGGG -3'
Posted On2016-11-09