Incidental Mutation 'R5685:Anxa6'
ID443298
Institutional Source Beutler Lab
Gene Symbol Anxa6
Ensembl Gene ENSMUSG00000018340
Gene Nameannexin A6
SynonymsAnxVI, Anx6, Cabm, Camb, Annexin VI
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R5685 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location54979108-55033445 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54996370 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 361 (N361D)
Ref Sequence ENSEMBL: ENSMUSP00000104511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102727] [ENSMUST00000108883]
Predicted Effect probably benign
Transcript: ENSMUST00000102727
AA Change: N361D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099788
Gene: ENSMUSG00000018340
AA Change: N361D

DomainStartEndE-ValueType
ANX 37 89 4.03e-19 SMART
ANX 109 161 2.09e-26 SMART
ANX 193 245 1.55e-20 SMART
ANX 268 320 2.23e-21 SMART
ANX 380 432 9.47e-25 SMART
ANX 452 504 1.12e-26 SMART
ANX 535 587 7.77e-12 SMART
ANX 610 662 4.73e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108883
AA Change: N361D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104511
Gene: ENSMUSG00000018340
AA Change: N361D

DomainStartEndE-ValueType
ANX 37 89 4.03e-19 SMART
ANX 109 161 2.09e-26 SMART
ANX 193 245 1.55e-20 SMART
ANX 268 320 2.23e-21 SMART
ANX 380 432 9.47e-25 SMART
ANX 452 504 1.12e-26 SMART
low complexity region 517 528 N/A INTRINSIC
ANX 541 593 7.77e-12 SMART
ANX 616 668 4.73e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148298
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Annexin VI belongs to a family of calcium-dependent membrane and phospholipid binding proteins. Several members of the annexin family have been implicated in membrane-related events along exocytotic and endocytotic pathways. The annexin VI gene is approximately 60 kbp long and contains 26 exons. It encodes a protein of about 68 kDa that consists of eight 68-amino acid repeats separated by linking sequences of variable lengths. It is highly similar to human annexins I and II sequences, each of which contain four such repeats. Annexin VI has been implicated in mediating the endosome aggregation and vesicle fusion in secreting epithelia during exocytosis. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele have normal immunological development but exhibit altered cardiomyocyte mechanics and intracellular calcium signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,230,550 probably benign Het
4921501E09Rik T A 17: 33,066,772 H352L probably benign Het
Abcb5 A T 12: 118,932,613 probably null Het
Abcg1 G T 17: 31,098,286 E191* probably null Het
Als2 A G 1: 59,179,091 Y1263H possibly damaging Het
Amer2 T A 14: 60,379,577 L281* probably null Het
Ap1g1 A T 8: 109,837,783 N320I probably damaging Het
Aqr T C 2: 114,156,265 D208G possibly damaging Het
Arnt2 T C 7: 84,263,265 T545A probably benign Het
Aspm G A 1: 139,487,288 V2701I probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Bbs2 A C 8: 94,087,433 F186V probably damaging Het
Catsperg2 G A 7: 29,701,188 P247L probably damaging Het
Cfap57 G T 4: 118,569,459 Q1098K probably benign Het
Cxcr6 A G 9: 123,810,746 T271A probably benign Het
Dock1 A G 7: 134,772,362 E579G probably benign Het
Frem3 A G 8: 80,695,303 T2111A probably damaging Het
Galnt1 A T 18: 24,264,529 D229V possibly damaging Het
Gbp2b A C 3: 142,608,158 M400L probably benign Het
Gm1123 T A 9: 99,009,433 probably null Het
Gtpbp6 T C 5: 110,104,939 H349R probably damaging Het
Hyal5 A G 6: 24,876,692 K188R probably benign Het
Insrr T C 3: 87,800,496 probably null Het
Kcnn1 A T 8: 70,852,730 C322S probably damaging Het
Kdelr1 GTCTA G 7: 45,881,617 probably null Het
Kif23 T C 9: 61,945,409 T8A probably benign Het
Lrrk2 A T 15: 91,803,301 R2198* probably null Het
Mcl1 T G 3: 95,659,798 D177E possibly damaging Het
Mrps11 A T 7: 78,791,880 T137S probably benign Het
Mtbp A G 15: 55,562,772 Y90C probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nxt1 G T 2: 148,675,753 W138L possibly damaging Het
Olfr1042 T C 2: 86,159,795 T192A probably damaging Het
Olfr1102 T A 2: 87,002,277 S103T probably benign Het
Olfr183 T A 16: 59,000,346 F220L probably benign Het
Osbpl7 C A 11: 97,060,277 P478H probably damaging Het
Pitpna T A 11: 75,620,269 F222I probably damaging Het
Plekhh2 A T 17: 84,569,882 R552W probably damaging Het
Plxnb2 C T 15: 89,167,032 R328H probably damaging Het
Pmaip1 C T 18: 66,460,984 T65I probably benign Het
Ppil4 T G 10: 7,798,422 I110S probably damaging Het
Prpf38a A G 4: 108,570,154 probably null Het
Psme4 G A 11: 30,809,837 G320D probably damaging Het
Rab17 C A 1: 90,958,957 R191L probably benign Het
Rhag A T 17: 40,831,331 M222L possibly damaging Het
Rims2 A T 15: 39,437,206 H111L possibly damaging Het
Setx T C 2: 29,171,280 Y2234H probably damaging Het
Slc2a8 T C 2: 32,981,789 I51V possibly damaging Het
Slc34a1 T C 13: 55,401,272 probably null Het
Slf1 T C 13: 77,083,479 T594A possibly damaging Het
Sox6 A T 7: 115,579,157 probably null Het
Spata13 C T 14: 60,691,203 S70L probably benign Het
Stard13 A G 5: 151,063,127 I188T possibly damaging Het
Stard9 A G 2: 120,705,322 D4020G probably damaging Het
Tdp1 A G 12: 99,902,352 K255R possibly damaging Het
Tns2 G T 15: 102,107,103 A124S probably benign Het
Top2b T A 14: 16,413,666 W1045R probably damaging Het
Trav12-2 T C 14: 53,616,665 V32A probably damaging Het
Vps13c G T 9: 67,963,173 R3198L possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp52 T A 17: 21,561,751 S620R probably benign Het
Zfp62 T A 11: 49,216,217 C378* probably null Het
Zfp638 C A 6: 83,929,987 P378H probably damaging Het
Other mutations in Anxa6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Anxa6 APN 11 54992363 missense probably damaging 1.00
IGL02450:Anxa6 APN 11 54994941 missense probably damaging 1.00
R0220:Anxa6 UTSW 11 54981762 intron probably null
R0374:Anxa6 UTSW 11 55005828 missense probably benign 0.02
R0599:Anxa6 UTSW 11 54979466 missense possibly damaging 0.92
R0659:Anxa6 UTSW 11 54983347 missense probably damaging 0.99
R0924:Anxa6 UTSW 11 54994388 splice site probably null
R0930:Anxa6 UTSW 11 54994388 splice site probably null
R1005:Anxa6 UTSW 11 55001218 missense possibly damaging 0.89
R1435:Anxa6 UTSW 11 54991410 missense probably benign
R2314:Anxa6 UTSW 11 55011735 missense probably damaging 1.00
R2850:Anxa6 UTSW 11 55011026 missense possibly damaging 0.94
R4596:Anxa6 UTSW 11 54994583 splice site probably null
R5057:Anxa6 UTSW 11 55001236 missense possibly damaging 0.82
R5968:Anxa6 UTSW 11 54994341 missense probably damaging 1.00
R6145:Anxa6 UTSW 11 54994904 missense probably damaging 0.98
R6268:Anxa6 UTSW 11 54987077 splice site probably null
R6818:Anxa6 UTSW 11 54979500 missense probably benign
R6864:Anxa6 UTSW 11 54986185 missense probably benign
R7224:Anxa6 UTSW 11 54986167 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTCCTCCTTATCCTGCAGAG -3'
(R):5'- AAGTCCGATTGCAGGAGCTG -3'

Sequencing Primer
(F):5'- TATCCTGCAGAGCCTCGTTGG -3'
(R):5'- AGGCCCACGACTCTCTG -3'
Posted On2016-11-09