Incidental Mutation 'R5685:Spata13'
ID443308
Institutional Source Beutler Lab
Gene Symbol Spata13
Ensembl Gene ENSMUSG00000021990
Gene Namespermatogenesis associated 13
SynonymsESTM11
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5685 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location60634001-60764556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 60691203 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 70 (S70L)
Ref Sequence ENSEMBL: ENSMUSP00000123928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022566] [ENSMUST00000159169] [ENSMUST00000159729] [ENSMUST00000160973]
Predicted Effect probably benign
Transcript: ENSMUST00000022566
AA Change: S70L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022566
Gene: ENSMUSG00000021990
AA Change: S70L

DomainStartEndE-ValueType
low complexity region 307 320 N/A INTRINSIC
low complexity region 354 370 N/A INTRINSIC
low complexity region 426 450 N/A INTRINSIC
low complexity region 453 462 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
low complexity region 571 584 N/A INTRINSIC
low complexity region 604 623 N/A INTRINSIC
SH3 742 797 4.92e-16 SMART
RhoGEF 836 1015 1.22e-58 SMART
PH 1048 1155 1.16e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159135
Predicted Effect probably benign
Transcript: ENSMUST00000159169
AA Change: S70L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000159729
AA Change: S70L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000160095
SMART Domains Protein: ENSMUSP00000123744
Gene: ENSMUSG00000021990

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 100 124 N/A INTRINSIC
low complexity region 127 136 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160973
AA Change: S70L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123928
Gene: ENSMUSG00000021990
AA Change: S70L

DomainStartEndE-ValueType
low complexity region 307 320 N/A INTRINSIC
low complexity region 354 370 N/A INTRINSIC
low complexity region 426 450 N/A INTRINSIC
low complexity region 453 462 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
low complexity region 571 584 N/A INTRINSIC
low complexity region 604 623 N/A INTRINSIC
SH3 742 797 4.92e-16 SMART
RhoGEF 836 1015 1.22e-58 SMART
PH 1048 1155 1.16e-9 SMART
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and overtly normal but show a significant reduction in the number and size of intestinal adenomas in conjunction with ApcMin heterozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,230,550 probably benign Het
4921501E09Rik T A 17: 33,066,772 H352L probably benign Het
Abcb5 A T 12: 118,932,613 probably null Het
Abcg1 G T 17: 31,098,286 E191* probably null Het
Als2 A G 1: 59,179,091 Y1263H possibly damaging Het
Amer2 T A 14: 60,379,577 L281* probably null Het
Anxa6 T C 11: 54,996,370 N361D probably benign Het
Ap1g1 A T 8: 109,837,783 N320I probably damaging Het
Aqr T C 2: 114,156,265 D208G possibly damaging Het
Arnt2 T C 7: 84,263,265 T545A probably benign Het
Aspm G A 1: 139,487,288 V2701I probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Bbs2 A C 8: 94,087,433 F186V probably damaging Het
Catsperg2 G A 7: 29,701,188 P247L probably damaging Het
Cfap57 G T 4: 118,569,459 Q1098K probably benign Het
Cxcr6 A G 9: 123,810,746 T271A probably benign Het
Dock1 A G 7: 134,772,362 E579G probably benign Het
Frem3 A G 8: 80,695,303 T2111A probably damaging Het
Galnt1 A T 18: 24,264,529 D229V possibly damaging Het
Gbp2b A C 3: 142,608,158 M400L probably benign Het
Gm1123 T A 9: 99,009,433 probably null Het
Gtpbp6 T C 5: 110,104,939 H349R probably damaging Het
Hyal5 A G 6: 24,876,692 K188R probably benign Het
Insrr T C 3: 87,800,496 probably null Het
Kcnn1 A T 8: 70,852,730 C322S probably damaging Het
Kdelr1 GTCTA G 7: 45,881,617 probably null Het
Kif23 T C 9: 61,945,409 T8A probably benign Het
Lrrk2 A T 15: 91,803,301 R2198* probably null Het
Mcl1 T G 3: 95,659,798 D177E possibly damaging Het
Mrps11 A T 7: 78,791,880 T137S probably benign Het
Mtbp A G 15: 55,562,772 Y90C probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nxt1 G T 2: 148,675,753 W138L possibly damaging Het
Olfr1042 T C 2: 86,159,795 T192A probably damaging Het
Olfr1102 T A 2: 87,002,277 S103T probably benign Het
Olfr183 T A 16: 59,000,346 F220L probably benign Het
Osbpl7 C A 11: 97,060,277 P478H probably damaging Het
Pitpna T A 11: 75,620,269 F222I probably damaging Het
Plekhh2 A T 17: 84,569,882 R552W probably damaging Het
Plxnb2 C T 15: 89,167,032 R328H probably damaging Het
Pmaip1 C T 18: 66,460,984 T65I probably benign Het
Ppil4 T G 10: 7,798,422 I110S probably damaging Het
Prpf38a A G 4: 108,570,154 probably null Het
Psme4 G A 11: 30,809,837 G320D probably damaging Het
Rab17 C A 1: 90,958,957 R191L probably benign Het
Rhag A T 17: 40,831,331 M222L possibly damaging Het
Rims2 A T 15: 39,437,206 H111L possibly damaging Het
Setx T C 2: 29,171,280 Y2234H probably damaging Het
Slc2a8 T C 2: 32,981,789 I51V possibly damaging Het
Slc34a1 T C 13: 55,401,272 probably null Het
Slf1 T C 13: 77,083,479 T594A possibly damaging Het
Sox6 A T 7: 115,579,157 probably null Het
Stard13 A G 5: 151,063,127 I188T possibly damaging Het
Stard9 A G 2: 120,705,322 D4020G probably damaging Het
Tdp1 A G 12: 99,902,352 K255R possibly damaging Het
Tns2 G T 15: 102,107,103 A124S probably benign Het
Top2b T A 14: 16,413,666 W1045R probably damaging Het
Trav12-2 T C 14: 53,616,665 V32A probably damaging Het
Vps13c G T 9: 67,963,173 R3198L possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp52 T A 17: 21,561,751 S620R probably benign Het
Zfp62 T A 11: 49,216,217 C378* probably null Het
Zfp638 C A 6: 83,929,987 P378H probably damaging Het
Other mutations in Spata13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02364:Spata13 APN 14 60691274 missense probably damaging 1.00
IGL02455:Spata13 APN 14 60706714 missense probably benign 0.01
IGL03189:Spata13 APN 14 60691614 missense possibly damaging 0.71
IGL03235:Spata13 APN 14 60751792 missense probably damaging 1.00
PIT4378001:Spata13 UTSW 14 60749996 missense probably damaging 1.00
R0278:Spata13 UTSW 14 60692088 missense probably benign 0.02
R0316:Spata13 UTSW 14 60692339 missense probably benign
R0458:Spata13 UTSW 14 60692043 missense probably damaging 0.98
R1546:Spata13 UTSW 14 60756408 missense probably damaging 1.00
R1780:Spata13 UTSW 14 60691725 missense probably damaging 0.96
R1791:Spata13 UTSW 14 60709459 missense probably damaging 1.00
R1970:Spata13 UTSW 14 60691463 missense probably damaging 0.99
R2059:Spata13 UTSW 14 60759591 missense possibly damaging 0.79
R2063:Spata13 UTSW 14 60760871 critical splice acceptor site probably benign
R2068:Spata13 UTSW 14 60760871 critical splice acceptor site probably benign
R2212:Spata13 UTSW 14 60706723 missense probably benign 0.00
R2327:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R3414:Spata13 UTSW 14 60706723 missense probably benign 0.00
R4115:Spata13 UTSW 14 60692478 missense probably damaging 1.00
R4276:Spata13 UTSW 14 60756296 missense probably damaging 1.00
R4289:Spata13 UTSW 14 60691074 missense probably damaging 1.00
R4291:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R4293:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R4294:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R4295:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R4779:Spata13 UTSW 14 60753907 nonsense probably null
R4780:Spata13 UTSW 14 60753907 nonsense probably null
R4838:Spata13 UTSW 14 60733179 missense probably benign 0.17
R4997:Spata13 UTSW 14 60709459 missense probably damaging 1.00
R5066:Spata13 UTSW 14 60750089 missense possibly damaging 0.78
R5399:Spata13 UTSW 14 60747541 missense probably benign 0.00
R5708:Spata13 UTSW 14 60692003 missense probably damaging 1.00
R5747:Spata13 UTSW 14 60747503 missense probably benign 0.00
R6073:Spata13 UTSW 14 60750021 missense probably damaging 1.00
R6135:Spata13 UTSW 14 60756428 missense probably damaging 0.98
R6233:Spata13 UTSW 14 60692007 missense probably benign 0.06
R6782:Spata13 UTSW 14 60691463 missense probably damaging 0.99
R6873:Spata13 UTSW 14 60691957 missense probably benign
R6958:Spata13 UTSW 14 60751851 missense possibly damaging 0.94
R7105:Spata13 UTSW 14 60753870 missense probably damaging 0.97
R7286:Spata13 UTSW 14 60756422 missense probably damaging 1.00
R7512:Spata13 UTSW 14 60751777 missense probably damaging 1.00
R7565:Spata13 UTSW 14 60751849 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGGAGATGAAGGTCTGG -3'
(R):5'- AAGGATGTACACCTGCCCAG -3'

Sequencing Primer
(F):5'- CAGTTACCGGCGTGAATGG -3'
(R):5'- TTTCCCAGGATGGCAACG -3'
Posted On2016-11-09