Incidental Mutation 'R5685:Zfp52'
ID443319
Institutional Source Beutler Lab
Gene Symbol Zfp52
Ensembl Gene ENSMUSG00000051341
Gene Namezinc finger protein 52
SynonymsKRAB11, Zfp-52, zfec29, Zfp76
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R5685 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location21555046-21562066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21561751 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 620 (S620R)
Ref Sequence ENSEMBL: ENSMUSP00000078233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079242]
Predicted Effect probably benign
Transcript: ENSMUST00000079242
AA Change: S620R

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000078233
Gene: ENSMUSG00000051341
AA Change: S620R

DomainStartEndE-ValueType
KRAB 13 73 3.79e-24 SMART
ZnF_C2H2 186 208 1.79e-2 SMART
ZnF_C2H2 214 236 5.07e0 SMART
ZnF_C2H2 242 264 2.29e1 SMART
ZnF_C2H2 270 292 2.36e-2 SMART
ZnF_C2H2 298 320 4.72e-2 SMART
ZnF_C2H2 326 348 1.77e1 SMART
ZnF_C2H2 382 404 1.12e-3 SMART
ZnF_C2H2 410 432 1.34e2 SMART
ZnF_C2H2 438 460 1.06e-4 SMART
ZnF_C2H2 466 488 6.99e-5 SMART
ZnF_C2H2 494 516 4.17e-3 SMART
ZnF_C2H2 522 544 5.5e-3 SMART
ZnF_C2H2 550 572 8.47e-4 SMART
ZnF_C2H2 578 600 1.01e-1 SMART
ZnF_C2H2 606 628 9.73e-4 SMART
ZnF_C2H2 634 656 4.17e-3 SMART
ZnF_C2H2 662 684 6.32e-3 SMART
ZnF_C2H2 690 712 1.69e-3 SMART
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,230,550 probably benign Het
4921501E09Rik T A 17: 33,066,772 H352L probably benign Het
Abcb5 A T 12: 118,932,613 probably null Het
Abcg1 G T 17: 31,098,286 E191* probably null Het
Als2 A G 1: 59,179,091 Y1263H possibly damaging Het
Amer2 T A 14: 60,379,577 L281* probably null Het
Anxa6 T C 11: 54,996,370 N361D probably benign Het
Ap1g1 A T 8: 109,837,783 N320I probably damaging Het
Aqr T C 2: 114,156,265 D208G possibly damaging Het
Arnt2 T C 7: 84,263,265 T545A probably benign Het
Aspm G A 1: 139,487,288 V2701I probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Bbs2 A C 8: 94,087,433 F186V probably damaging Het
Catsperg2 G A 7: 29,701,188 P247L probably damaging Het
Cfap57 G T 4: 118,569,459 Q1098K probably benign Het
Cxcr6 A G 9: 123,810,746 T271A probably benign Het
Dock1 A G 7: 134,772,362 E579G probably benign Het
Frem3 A G 8: 80,695,303 T2111A probably damaging Het
Galnt1 A T 18: 24,264,529 D229V possibly damaging Het
Gbp2b A C 3: 142,608,158 M400L probably benign Het
Gm1123 T A 9: 99,009,433 probably null Het
Gtpbp6 T C 5: 110,104,939 H349R probably damaging Het
Hyal5 A G 6: 24,876,692 K188R probably benign Het
Insrr T C 3: 87,800,496 probably null Het
Kcnn1 A T 8: 70,852,730 C322S probably damaging Het
Kdelr1 GTCTA G 7: 45,881,617 probably null Het
Kif23 T C 9: 61,945,409 T8A probably benign Het
Lrrk2 A T 15: 91,803,301 R2198* probably null Het
Mcl1 T G 3: 95,659,798 D177E possibly damaging Het
Mrps11 A T 7: 78,791,880 T137S probably benign Het
Mtbp A G 15: 55,562,772 Y90C probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nxt1 G T 2: 148,675,753 W138L possibly damaging Het
Olfr1042 T C 2: 86,159,795 T192A probably damaging Het
Olfr1102 T A 2: 87,002,277 S103T probably benign Het
Olfr183 T A 16: 59,000,346 F220L probably benign Het
Osbpl7 C A 11: 97,060,277 P478H probably damaging Het
Pitpna T A 11: 75,620,269 F222I probably damaging Het
Plekhh2 A T 17: 84,569,882 R552W probably damaging Het
Plxnb2 C T 15: 89,167,032 R328H probably damaging Het
Pmaip1 C T 18: 66,460,984 T65I probably benign Het
Ppil4 T G 10: 7,798,422 I110S probably damaging Het
Prpf38a A G 4: 108,570,154 probably null Het
Psme4 G A 11: 30,809,837 G320D probably damaging Het
Rab17 C A 1: 90,958,957 R191L probably benign Het
Rhag A T 17: 40,831,331 M222L possibly damaging Het
Rims2 A T 15: 39,437,206 H111L possibly damaging Het
Setx T C 2: 29,171,280 Y2234H probably damaging Het
Slc2a8 T C 2: 32,981,789 I51V possibly damaging Het
Slc34a1 T C 13: 55,401,272 probably null Het
Slf1 T C 13: 77,083,479 T594A possibly damaging Het
Sox6 A T 7: 115,579,157 probably null Het
Spata13 C T 14: 60,691,203 S70L probably benign Het
Stard13 A G 5: 151,063,127 I188T possibly damaging Het
Stard9 A G 2: 120,705,322 D4020G probably damaging Het
Tdp1 A G 12: 99,902,352 K255R possibly damaging Het
Tns2 G T 15: 102,107,103 A124S probably benign Het
Top2b T A 14: 16,413,666 W1045R probably damaging Het
Trav12-2 T C 14: 53,616,665 V32A probably damaging Het
Vps13c G T 9: 67,963,173 R3198L possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp62 T A 11: 49,216,217 C378* probably null Het
Zfp638 C A 6: 83,929,987 P378H probably damaging Het
Other mutations in Zfp52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01752:Zfp52 APN 17 21560150 missense probably benign 0.12
PIT4449001:Zfp52 UTSW 17 21557216 missense probably damaging 1.00
R0270:Zfp52 UTSW 17 21561302 missense probably damaging 1.00
R0674:Zfp52 UTSW 17 21561846 missense probably damaging 1.00
R1224:Zfp52 UTSW 17 21555062 missense possibly damaging 0.70
R1248:Zfp52 UTSW 17 21560049 missense probably damaging 1.00
R1622:Zfp52 UTSW 17 21561571 missense probably benign 0.00
R1663:Zfp52 UTSW 17 21561822 missense possibly damaging 0.59
R1917:Zfp52 UTSW 17 21560164 missense probably benign
R4272:Zfp52 UTSW 17 21560197 nonsense probably null
R4273:Zfp52 UTSW 17 21560197 nonsense probably null
R4278:Zfp52 UTSW 17 21561870 missense probably benign
R4683:Zfp52 UTSW 17 21561507 missense probably benign 0.31
R4865:Zfp52 UTSW 17 21561243 missense probably damaging 1.00
R4964:Zfp52 UTSW 17 21560403 missense probably benign 0.04
R4966:Zfp52 UTSW 17 21560403 missense probably benign 0.04
R5430:Zfp52 UTSW 17 21555067 missense probably benign 0.01
R6133:Zfp52 UTSW 17 21560471 missense probably damaging 1.00
R6882:Zfp52 UTSW 17 21555047 start codon destroyed probably null 1.00
R7083:Zfp52 UTSW 17 21560130 missense possibly damaging 0.86
R7439:Zfp52 UTSW 17 21560870 nonsense probably null
R7456:Zfp52 UTSW 17 21561353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGACCATCAGAAAATTCATACTGGAG -3'
(R):5'- TGATTTGCAAGCAGAGAATACCAG -3'

Sequencing Primer
(F):5'- ACTGGAGAGAAACTTTACAAATGC -3'
(R):5'- CTCCAGAATGAGTTCTCTGATGGAC -3'
Posted On2016-11-09