Incidental Mutation 'R5686:Bcas1'
ID443340
Institutional Source Beutler Lab
Gene Symbol Bcas1
Ensembl Gene ENSMUSG00000013523
Gene Namebreast carcinoma amplified sequence 1
Synonyms9030223A09Rik, 2210416M21Rik, NABC1
MMRRC Submission 043319-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R5686 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location170346991-170427845 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 170406810 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 64 (T64A)
Ref Sequence ENSEMBL: ENSMUSP00000013667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013667] [ENSMUST00000068137] [ENSMUST00000109152]
Predicted Effect probably benign
Transcript: ENSMUST00000013667
AA Change: T64A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000013667
Gene: ENSMUSG00000013523
AA Change: T64A

DomainStartEndE-ValueType
low complexity region 174 187 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 391 398 N/A INTRINSIC
low complexity region 542 554 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068137
AA Change: T54A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069437
Gene: ENSMUSG00000013523
AA Change: T54A

DomainStartEndE-ValueType
low complexity region 164 177 N/A INTRINSIC
low complexity region 289 302 N/A INTRINSIC
low complexity region 335 342 N/A INTRINSIC
low complexity region 486 498 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109152
AA Change: T64A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104780
Gene: ENSMUSG00000013523
AA Change: T64A

DomainStartEndE-ValueType
low complexity region 174 187 N/A INTRINSIC
low complexity region 299 312 N/A INTRINSIC
low complexity region 345 352 N/A INTRINSIC
low complexity region 496 508 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145920
Predicted Effect probably benign
Transcript: ENSMUST00000154650
SMART Domains Protein: ENSMUSP00000122298
Gene: ENSMUSG00000013523

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
low complexity region 228 235 N/A INTRINSIC
low complexity region 288 300 N/A INTRINSIC
Meta Mutation Damage Score 0.282 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene resides in a region at 20q13 which is amplified in a variety of tumor types and associated with more aggressive tumor phenotypes. Among the genes identified from this region, it was found to be highly expressed in three amplified breast cancer cell lines and in one breast tumor without amplification at 20q13.2. However, this gene is not in the common region of maximal amplification and its expression was not detected in the breast cancer cell line MCF7, in which this region is highly amplified. Although not consistently expressed, this gene is a candidate oncogene. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,303,314 E839G possibly damaging Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
4932438A13Rik T A 3: 36,917,660 F514Y probably benign Het
Adgrf3 T A 5: 30,197,306 T575S probably damaging Het
Akap9 T A 5: 3,971,926 C1158S probably benign Het
Arhgap39 A G 15: 76,726,633 F926L probably damaging Het
BC035947 G T 1: 78,497,930 T655K probably benign Het
Brca2 A G 5: 150,540,904 K1378E probably benign Het
Card6 A T 15: 5,100,953 N320K probably damaging Het
Ccdc3 A T 2: 5,138,060 I43F probably damaging Het
Cd200r1 T C 16: 44,790,164 S212P probably damaging Het
Cdh8 T C 8: 99,033,222 I632V probably benign Het
Col25a1 A G 3: 130,564,154 E477G probably damaging Het
Cpne5 A T 17: 29,184,017 C215S possibly damaging Het
Crim1 T A 17: 78,374,083 S989T possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dync1h1 T A 12: 110,616,404 N340K probably benign Het
Eif4e2 G A 1: 87,226,238 probably null Het
Ephb6 G T 6: 41,619,704 R895L possibly damaging Het
Esrrg T A 1: 188,150,198 H217Q probably benign Het
Fgl1 T A 8: 41,200,557 K100* probably null Het
Flt4 T C 11: 49,630,603 V450A probably benign Het
G6pc2 A T 2: 69,220,784 I74L probably benign Het
Gabrr1 T C 4: 33,161,684 M336T probably damaging Het
Gli1 T A 10: 127,337,436 T118S probably benign Het
Gm5435 A T 12: 82,496,026 noncoding transcript Het
Got1l1 A G 8: 27,198,059 L314P probably damaging Het
Hk3 T A 13: 55,006,813 I740F probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Igsf9b A G 9: 27,324,179 T508A probably damaging Het
Il16 T A 7: 83,648,728 N431I probably benign Het
Lax1 G A 1: 133,680,176 P276S probably damaging Het
Lrp2 A T 2: 69,511,061 V925E possibly damaging Het
Lrp3 T A 7: 35,203,485 T479S possibly damaging Het
Metrn G A 17: 25,795,217 R212C probably damaging Het
Mlip A C 9: 77,347,693 probably null Het
Mmp24 C T 2: 155,799,777 T175I probably damaging Het
N6amt1 A T 16: 87,354,335 D28V probably damaging Het
Olfr1289 G A 2: 111,484,143 G238R probably damaging Het
Olfr215 T C 6: 116,582,929 T6A probably benign Het
Olfr380 A T 11: 73,453,851 Y120* probably null Het
Olfr472 A G 7: 107,902,912 H65R probably damaging Het
Olfr490 G T 7: 108,286,742 A128E probably damaging Het
Olfr870 T A 9: 20,170,969 I201F possibly damaging Het
Pcdh17 T A 14: 84,532,993 N970K probably damaging Het
Pdzrn3 T C 6: 101,151,428 Y759C probably damaging Het
Pkd2l2 T C 18: 34,425,237 L323P probably damaging Het
Psg21 G T 7: 18,652,258 probably benign Het
Rest T C 5: 77,281,726 V664A probably benign Het
Sco2 G A 15: 89,371,972 R160* probably null Het
Sfswap T A 5: 129,514,818 S300T probably damaging Het
Slc5a10 A T 11: 61,678,566 M329K probably benign Het
Slco1a5 G A 6: 142,236,307 P564S probably damaging Het
Stk38 A G 17: 28,982,129 F191S probably damaging Het
Svep1 T A 4: 58,072,826 Y2161F possibly damaging Het
Tada2a G A 11: 84,079,602 T441M possibly damaging Het
Tg T A 15: 66,688,889 N1033K probably benign Het
Thoc3 A T 13: 54,467,873 I126N probably damaging Het
Tnc T C 4: 64,007,730 probably null Het
Tnc A T 4: 64,008,795 D831E possibly damaging Het
Uhmk1 A T 1: 170,211,218 V100E probably damaging Het
Usp43 G A 11: 67,921,916 probably benign Het
Vmn2r90 A T 17: 17,713,450 Y424F probably benign Het
Vps33a C T 5: 123,547,001 probably null Het
Xirp2 A T 2: 67,482,298 K37I probably damaging Het
Zfp106 A T 2: 120,533,507 probably null Het
Zfp748 A T 13: 67,542,528 C204* probably null Het
Other mutations in Bcas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Bcas1 APN 2 170349252 missense probably damaging 0.99
IGL01714:Bcas1 APN 2 170384182 splice site probably benign
IGL02267:Bcas1 APN 2 170378788 nonsense probably null
IGL02486:Bcas1 APN 2 170406398 missense probably damaging 1.00
IGL03328:Bcas1 APN 2 170366396 nonsense probably null
R0335:Bcas1 UTSW 2 170418681 missense probably damaging 0.97
R1458:Bcas1 UTSW 2 170387951 missense probably damaging 1.00
R1463:Bcas1 UTSW 2 170418664 missense probably benign 0.07
R1467:Bcas1 UTSW 2 170387932 missense possibly damaging 0.92
R1467:Bcas1 UTSW 2 170387932 missense possibly damaging 0.92
R1507:Bcas1 UTSW 2 170366428 missense probably damaging 0.99
R1645:Bcas1 UTSW 2 170387167 missense probably damaging 1.00
R1654:Bcas1 UTSW 2 170349246 missense probably damaging 1.00
R1911:Bcas1 UTSW 2 170387943 missense probably damaging 1.00
R1990:Bcas1 UTSW 2 170370477 missense possibly damaging 0.83
R2017:Bcas1 UTSW 2 170348161 splice site probably null
R4119:Bcas1 UTSW 2 170378815 missense probably benign 0.02
R4181:Bcas1 UTSW 2 170418627 missense probably benign 0.26
R4302:Bcas1 UTSW 2 170418627 missense probably benign 0.26
R4497:Bcas1 UTSW 2 170406821 missense probably damaging 1.00
R4670:Bcas1 UTSW 2 170384325 missense probably damaging 0.99
R4671:Bcas1 UTSW 2 170384325 missense probably damaging 0.99
R4914:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R4915:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R4917:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R4918:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R5155:Bcas1 UTSW 2 170418618 missense probably damaging 0.98
R5354:Bcas1 UTSW 2 170349396 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCTGACATCAAACCTCCCTG -3'
(R):5'- AGGGTCTCTCTTCCAGGAAG -3'

Sequencing Primer
(F):5'- GATGCAGCCGATGAATCCGTG -3'
(R):5'- TCTTCCAGGAAGAGCAGGGTC -3'
Posted On2016-11-09