Incidental Mutation 'R5686:Col25a1'
ID443342
Institutional Source Beutler Lab
Gene Symbol Col25a1
Ensembl Gene ENSMUSG00000058897
Gene Namecollagen, type XXV, alpha 1
Synonyms2700062B08Rik
MMRRC Submission 043319-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5686 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location130131501-130599877 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130564154 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 477 (E477G)
Ref Sequence ENSEMBL: ENSMUSP00000138875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080335] [ENSMUST00000106353] [ENSMUST00000183368]
Predicted Effect probably damaging
Transcript: ENSMUST00000080335
AA Change: E477G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079210
Gene: ENSMUSG00000058897
AA Change: E477G

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:Collagen 119 165 7e-9 PFAM
low complexity region 188 246 N/A INTRINSIC
low complexity region 275 288 N/A INTRINSIC
Pfam:Collagen 311 374 5.4e-11 PFAM
Pfam:Collagen 368 427 2e-9 PFAM
Pfam:Collagen 447 504 1.6e-10 PFAM
Pfam:Collagen 494 561 3.3e-8 PFAM
Pfam:Collagen 586 660 4.3e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106353
AA Change: E449G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101960
Gene: ENSMUSG00000058897
AA Change: E449G

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:Collagen 119 174 1.7e-11 PFAM
Pfam:Collagen 183 244 6.2e-12 PFAM
Pfam:Collagen 233 297 7.5e-11 PFAM
Pfam:Collagen 294 345 1.8e-9 PFAM
Pfam:Collagen 343 399 1.1e-10 PFAM
Pfam:Collagen 419 475 1.9e-10 PFAM
low complexity region 490 525 N/A INTRINSIC
Pfam:Collagen 555 622 6e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183368
AA Change: E477G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138875
Gene: ENSMUSG00000058897
AA Change: E477G

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:Collagen 119 165 6.8e-9 PFAM
low complexity region 188 246 N/A INTRINSIC
internal_repeat_2 249 294 2.8e-5 PROSPERO
internal_repeat_1 294 308 4.06e-8 PROSPERO
Pfam:Collagen 309 372 2.1e-11 PFAM
Pfam:Collagen 371 427 3.7e-10 PFAM
Pfam:Collagen 447 496 7.7e-10 PFAM
low complexity region 497 506 N/A INTRINSIC
low complexity region 514 527 N/A INTRINSIC
low complexity region 556 571 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196901
Meta Mutation Damage Score 0.176 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a brain-specific membrane associated collagen. A product of proteolytic processing of the encoded protein, CLAC (collagenous Alzheimer amyloid plaque component), binds to amyloid beta-peptides found in Alzheimer amyloid plaques but CLAC inhibits rather than facilitates amyloid fibril elongation (PMID: 16300410). A study of over-expression of this collagen in mice, however, found changes in pathology and behavior suggesting that the encoded protein may promote amyloid plaque formation (PMID: 19548013). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, cyanosis and abnormal body curvature with apoptosis of phrenic nerve motor neurons and failure of diaphragm innervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,303,314 E839G possibly damaging Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
4932438A13Rik T A 3: 36,917,660 F514Y probably benign Het
Adgrf3 T A 5: 30,197,306 T575S probably damaging Het
Akap9 T A 5: 3,971,926 C1158S probably benign Het
Arhgap39 A G 15: 76,726,633 F926L probably damaging Het
BC035947 G T 1: 78,497,930 T655K probably benign Het
Bcas1 T C 2: 170,406,810 T64A probably benign Het
Brca2 A G 5: 150,540,904 K1378E probably benign Het
Card6 A T 15: 5,100,953 N320K probably damaging Het
Ccdc3 A T 2: 5,138,060 I43F probably damaging Het
Cd200r1 T C 16: 44,790,164 S212P probably damaging Het
Cdh8 T C 8: 99,033,222 I632V probably benign Het
Cpne5 A T 17: 29,184,017 C215S possibly damaging Het
Crim1 T A 17: 78,374,083 S989T possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dync1h1 T A 12: 110,616,404 N340K probably benign Het
Eif4e2 G A 1: 87,226,238 probably null Het
Ephb6 G T 6: 41,619,704 R895L possibly damaging Het
Esrrg T A 1: 188,150,198 H217Q probably benign Het
Fgl1 T A 8: 41,200,557 K100* probably null Het
Flt4 T C 11: 49,630,603 V450A probably benign Het
G6pc2 A T 2: 69,220,784 I74L probably benign Het
Gabrr1 T C 4: 33,161,684 M336T probably damaging Het
Gli1 T A 10: 127,337,436 T118S probably benign Het
Gm5435 A T 12: 82,496,026 noncoding transcript Het
Got1l1 A G 8: 27,198,059 L314P probably damaging Het
Hk3 T A 13: 55,006,813 I740F probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Igsf9b A G 9: 27,324,179 T508A probably damaging Het
Il16 T A 7: 83,648,728 N431I probably benign Het
Lax1 G A 1: 133,680,176 P276S probably damaging Het
Lrp2 A T 2: 69,511,061 V925E possibly damaging Het
Lrp3 T A 7: 35,203,485 T479S possibly damaging Het
Metrn G A 17: 25,795,217 R212C probably damaging Het
Mlip A C 9: 77,347,693 probably null Het
Mmp24 C T 2: 155,799,777 T175I probably damaging Het
N6amt1 A T 16: 87,354,335 D28V probably damaging Het
Olfr1289 G A 2: 111,484,143 G238R probably damaging Het
Olfr215 T C 6: 116,582,929 T6A probably benign Het
Olfr380 A T 11: 73,453,851 Y120* probably null Het
Olfr472 A G 7: 107,902,912 H65R probably damaging Het
Olfr490 G T 7: 108,286,742 A128E probably damaging Het
Olfr870 T A 9: 20,170,969 I201F possibly damaging Het
Pcdh17 T A 14: 84,532,993 N970K probably damaging Het
Pdzrn3 T C 6: 101,151,428 Y759C probably damaging Het
Pkd2l2 T C 18: 34,425,237 L323P probably damaging Het
Psg21 G T 7: 18,652,258 probably benign Het
Rest T C 5: 77,281,726 V664A probably benign Het
Sco2 G A 15: 89,371,972 R160* probably null Het
Sfswap T A 5: 129,514,818 S300T probably damaging Het
Slc5a10 A T 11: 61,678,566 M329K probably benign Het
Slco1a5 G A 6: 142,236,307 P564S probably damaging Het
Stk38 A G 17: 28,982,129 F191S probably damaging Het
Svep1 T A 4: 58,072,826 Y2161F possibly damaging Het
Tada2a G A 11: 84,079,602 T441M possibly damaging Het
Tg T A 15: 66,688,889 N1033K probably benign Het
Thoc3 A T 13: 54,467,873 I126N probably damaging Het
Tnc T C 4: 64,007,730 probably null Het
Tnc A T 4: 64,008,795 D831E possibly damaging Het
Uhmk1 A T 1: 170,211,218 V100E probably damaging Het
Usp43 G A 11: 67,921,916 probably benign Het
Vmn2r90 A T 17: 17,713,450 Y424F probably benign Het
Vps33a C T 5: 123,547,001 probably null Het
Xirp2 A T 2: 67,482,298 K37I probably damaging Het
Zfp106 A T 2: 120,533,507 probably null Het
Zfp748 A T 13: 67,542,528 C204* probably null Het
Other mutations in Col25a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Col25a1 APN 3 130181784 splice site probably benign
IGL00570:Col25a1 APN 3 130546432 splice site probably benign
IGL01651:Col25a1 APN 3 130566485 missense probably benign 0.06
IGL02033:Col25a1 APN 3 130388948 splice site probably benign
IGL02117:Col25a1 APN 3 130519773 splice site probably benign
IGL02290:Col25a1 APN 3 130519811 splice site probably benign
IGL03135:Col25a1 APN 3 130529683 splice site probably benign
R0526:Col25a1 UTSW 3 130476394 missense probably damaging 1.00
R0602:Col25a1 UTSW 3 130575414 splice site probably null
R0670:Col25a1 UTSW 3 130386895 missense possibly damaging 0.95
R0830:Col25a1 UTSW 3 130584726 missense probably damaging 1.00
R1220:Col25a1 UTSW 3 130388925 splice site probably benign
R1623:Col25a1 UTSW 3 130550050 missense probably damaging 1.00
R1818:Col25a1 UTSW 3 130585737 critical splice donor site probably null
R2142:Col25a1 UTSW 3 130570316 missense probably damaging 1.00
R2190:Col25a1 UTSW 3 130584715 missense probably damaging 1.00
R2901:Col25a1 UTSW 3 130546391 missense probably damaging 1.00
R2902:Col25a1 UTSW 3 130546391 missense probably damaging 1.00
R3703:Col25a1 UTSW 3 130550033 splice site probably null
R3818:Col25a1 UTSW 3 130550071 missense possibly damaging 0.88
R4726:Col25a1 UTSW 3 130519781 missense possibly damaging 0.92
R4775:Col25a1 UTSW 3 130182819 missense possibly damaging 0.96
R5036:Col25a1 UTSW 3 130583329 splice site probably null
R5110:Col25a1 UTSW 3 130584725 makesense probably null
R5501:Col25a1 UTSW 3 130595663 missense probably benign 0.07
R5698:Col25a1 UTSW 3 130478983 critical splice acceptor site probably null
R6131:Col25a1 UTSW 3 130535465 missense probably damaging 1.00
R6142:Col25a1 UTSW 3 130583329 splice site probably benign
R6549:Col25a1 UTSW 3 130182795 missense probably benign
R6624:Col25a1 UTSW 3 130566451 splice site probably null
R6898:Col25a1 UTSW 3 130584728 critical splice donor site probably null
R7030:Col25a1 UTSW 3 130479022 critical splice donor site probably null
R7114:Col25a1 UTSW 3 130595675 missense probably benign 0.06
R7179:Col25a1 UTSW 3 130530119 missense probably damaging 0.99
X0028:Col25a1 UTSW 3 130577318 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GTAGGACTTGGCTAGCCATTAC -3'
(R):5'- ATCTGTTGAGGTAGACTGATAGGTC -3'

Sequencing Primer
(F):5'- GCACAATCCTCAAGAAAGATTTTTCC -3'
(R):5'- ACATAGCTTTACATTTCTACCAACC -3'
Posted On2016-11-09