Incidental Mutation 'R5686:Pdzrn3'
ID443356
Institutional Source Beutler Lab
Gene Symbol Pdzrn3
Ensembl Gene ENSMUSG00000035357
Gene NamePDZ domain containing RING finger 3
SynonymsLNX3, semaphorin cytoplasmic domain-associated protein 3A, Semcap3, 1110020C07Rik
MMRRC Submission 043319-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.599) question?
Stock #R5686 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location101149609-101377897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101151428 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 759 (Y759C)
Ref Sequence ENSEMBL: ENSMUSP00000075376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075994]
Predicted Effect probably damaging
Transcript: ENSMUST00000075994
AA Change: Y759C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075376
Gene: ENSMUSG00000035357
AA Change: Y759C

DomainStartEndE-ValueType
RING 18 55 3.93e-3 SMART
low complexity region 198 214 N/A INTRINSIC
PDZ 257 339 3.38e-21 SMART
PDZ 429 504 3.86e-16 SMART
low complexity region 512 526 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 1020 1029 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205008
Meta Mutation Damage Score 0.418 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LNX (Ligand of Numb Protein-X) family of RING-type ubiquitin E3 ligases. This protein may function in vascular morphogenesis and the differentiation of adipocytes, osteoblasts and myoblasts. This protein may be targeted for degradation by the human papilloma virus E6 protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,303,314 E839G possibly damaging Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
4932438A13Rik T A 3: 36,917,660 F514Y probably benign Het
Adgrf3 T A 5: 30,197,306 T575S probably damaging Het
Akap9 T A 5: 3,971,926 C1158S probably benign Het
Arhgap39 A G 15: 76,726,633 F926L probably damaging Het
BC035947 G T 1: 78,497,930 T655K probably benign Het
Bcas1 T C 2: 170,406,810 T64A probably benign Het
Brca2 A G 5: 150,540,904 K1378E probably benign Het
Card6 A T 15: 5,100,953 N320K probably damaging Het
Ccdc3 A T 2: 5,138,060 I43F probably damaging Het
Cd200r1 T C 16: 44,790,164 S212P probably damaging Het
Cdh8 T C 8: 99,033,222 I632V probably benign Het
Col25a1 A G 3: 130,564,154 E477G probably damaging Het
Cpne5 A T 17: 29,184,017 C215S possibly damaging Het
Crim1 T A 17: 78,374,083 S989T possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dync1h1 T A 12: 110,616,404 N340K probably benign Het
Eif4e2 G A 1: 87,226,238 probably null Het
Ephb6 G T 6: 41,619,704 R895L possibly damaging Het
Esrrg T A 1: 188,150,198 H217Q probably benign Het
Fgl1 T A 8: 41,200,557 K100* probably null Het
Flt4 T C 11: 49,630,603 V450A probably benign Het
G6pc2 A T 2: 69,220,784 I74L probably benign Het
Gabrr1 T C 4: 33,161,684 M336T probably damaging Het
Gli1 T A 10: 127,337,436 T118S probably benign Het
Gm5435 A T 12: 82,496,026 noncoding transcript Het
Got1l1 A G 8: 27,198,059 L314P probably damaging Het
Hk3 T A 13: 55,006,813 I740F probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Igsf9b A G 9: 27,324,179 T508A probably damaging Het
Il16 T A 7: 83,648,728 N431I probably benign Het
Lax1 G A 1: 133,680,176 P276S probably damaging Het
Lrp2 A T 2: 69,511,061 V925E possibly damaging Het
Lrp3 T A 7: 35,203,485 T479S possibly damaging Het
Metrn G A 17: 25,795,217 R212C probably damaging Het
Mlip A C 9: 77,347,693 probably null Het
Mmp24 C T 2: 155,799,777 T175I probably damaging Het
N6amt1 A T 16: 87,354,335 D28V probably damaging Het
Olfr1289 G A 2: 111,484,143 G238R probably damaging Het
Olfr215 T C 6: 116,582,929 T6A probably benign Het
Olfr380 A T 11: 73,453,851 Y120* probably null Het
Olfr472 A G 7: 107,902,912 H65R probably damaging Het
Olfr490 G T 7: 108,286,742 A128E probably damaging Het
Olfr870 T A 9: 20,170,969 I201F possibly damaging Het
Pcdh17 T A 14: 84,532,993 N970K probably damaging Het
Pkd2l2 T C 18: 34,425,237 L323P probably damaging Het
Psg21 G T 7: 18,652,258 probably benign Het
Rest T C 5: 77,281,726 V664A probably benign Het
Sco2 G A 15: 89,371,972 R160* probably null Het
Sfswap T A 5: 129,514,818 S300T probably damaging Het
Slc5a10 A T 11: 61,678,566 M329K probably benign Het
Slco1a5 G A 6: 142,236,307 P564S probably damaging Het
Stk38 A G 17: 28,982,129 F191S probably damaging Het
Svep1 T A 4: 58,072,826 Y2161F possibly damaging Het
Tada2a G A 11: 84,079,602 T441M possibly damaging Het
Tg T A 15: 66,688,889 N1033K probably benign Het
Thoc3 A T 13: 54,467,873 I126N probably damaging Het
Tnc T C 4: 64,007,730 probably null Het
Tnc A T 4: 64,008,795 D831E possibly damaging Het
Uhmk1 A T 1: 170,211,218 V100E probably damaging Het
Usp43 G A 11: 67,921,916 probably benign Het
Vmn2r90 A T 17: 17,713,450 Y424F probably benign Het
Vps33a C T 5: 123,547,001 probably null Het
Xirp2 A T 2: 67,482,298 K37I probably damaging Het
Zfp106 A T 2: 120,533,507 probably null Het
Zfp748 A T 13: 67,542,528 C204* probably null Het
Other mutations in Pdzrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Pdzrn3 APN 6 101354486 missense probably benign 0.01
IGL01511:Pdzrn3 APN 6 101153256 missense possibly damaging 0.66
IGL01554:Pdzrn3 APN 6 101150541 missense probably damaging 1.00
IGL02450:Pdzrn3 APN 6 101354500 missense probably damaging 1.00
IGL02505:Pdzrn3 APN 6 101151938 missense possibly damaging 0.94
IGL03061:Pdzrn3 APN 6 101151855 missense probably damaging 1.00
IGL03210:Pdzrn3 APN 6 101156952 missense possibly damaging 0.95
implevit_bonis UTSW 6 101151022 missense probably benign 0.15
tendency UTSW 6 101151428 missense probably damaging 1.00
PIT4581001:Pdzrn3 UTSW 6 101151503 missense probably benign 0.00
R0110:Pdzrn3 UTSW 6 101151053 missense probably damaging 1.00
R0469:Pdzrn3 UTSW 6 101151053 missense probably damaging 1.00
R0496:Pdzrn3 UTSW 6 101150570 missense possibly damaging 0.94
R0510:Pdzrn3 UTSW 6 101151053 missense probably damaging 1.00
R0883:Pdzrn3 UTSW 6 101155942 splice site probably null
R1171:Pdzrn3 UTSW 6 101150877 missense probably damaging 1.00
R1471:Pdzrn3 UTSW 6 101151512 missense possibly damaging 0.77
R1496:Pdzrn3 UTSW 6 101150969 missense probably benign 0.00
R1596:Pdzrn3 UTSW 6 101151005 missense probably benign 0.03
R2033:Pdzrn3 UTSW 6 101150954 missense probably damaging 1.00
R2068:Pdzrn3 UTSW 6 101150699 missense probably damaging 1.00
R2084:Pdzrn3 UTSW 6 101154295 missense probably benign 0.35
R2432:Pdzrn3 UTSW 6 101150791 missense probably damaging 1.00
R3727:Pdzrn3 UTSW 6 101156945 missense probably damaging 0.98
R3861:Pdzrn3 UTSW 6 101172371 missense possibly damaging 0.95
R4616:Pdzrn3 UTSW 6 101152009 missense probably damaging 0.99
R4967:Pdzrn3 UTSW 6 101151590 missense probably damaging 1.00
R5224:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5226:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5227:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5230:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5320:Pdzrn3 UTSW 6 101151103 missense probably damaging 1.00
R5414:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5772:Pdzrn3 UTSW 6 101172314 missense probably benign 0.00
R6026:Pdzrn3 UTSW 6 101362144 missense probably benign 0.40
R6213:Pdzrn3 UTSW 6 101377844 missense probably damaging 1.00
R6518:Pdzrn3 UTSW 6 101150514 makesense probably null
R6657:Pdzrn3 UTSW 6 101151022 missense probably benign 0.15
R6951:Pdzrn3 UTSW 6 101154192 critical splice donor site probably null
R7055:Pdzrn3 UTSW 6 101151774 nonsense probably null
R7290:Pdzrn3 UTSW 6 101151245 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCTTTGGCACTAGGGTTATAGC -3'
(R):5'- TCAATGAGGAGTTGCGCAG -3'

Sequencing Primer
(F):5'- ATAGCTTGGGGTGCTTACTTCAG -3'
(R):5'- ATCGAGCTGGAGTGCCTGAG -3'
Posted On2016-11-09