Incidental Mutation 'R5686:Cdh8'
ID443367
Institutional Source Beutler Lab
Gene Symbol Cdh8
Ensembl Gene ENSMUSG00000036510
Gene Namecadherin 8
Synonymscad8
MMRRC Submission 043319-MU
Accession Numbers

Ncbi RefSeq: NM_001039154.1, NM_007667.2; MGI:107434

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5686 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location99024471-99416471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99033222 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 632 (I632V)
Ref Sequence ENSEMBL: ENSMUSP00000123619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093249] [ENSMUST00000128860] [ENSMUST00000142129] [ENSMUST00000145601] [ENSMUST00000155527]
Predicted Effect probably benign
Transcript: ENSMUST00000093249
AA Change: I632V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000090935
Gene: ENSMUSG00000036510
AA Change: I632V

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 645 712 1.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128860
AA Change: I632V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117326
Gene: ENSMUSG00000036510
AA Change: I632V

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 647 792 7e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142129
AA Change: I632V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114507
Gene: ENSMUSG00000036510
AA Change: I632V

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 645 702 5.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145601
SMART Domains Protein: ENSMUSP00000122493
Gene: ENSMUSG00000036510

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 502 1.27e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155527
AA Change: I632V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123619
Gene: ENSMUSG00000036510
AA Change: I632V

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 645 745 1.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161244
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (73/75)
MGI Phenotype Strain: 3707077
FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Mice lacking the encoded protein exhibit reduced behavioral responses to cold, but not thermal stimuli. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele are viable, fertile and overtly normal but display abnormal CNS synaptic transmission, raise their tails in response to stress, and show reduced sensitivity to cutaneous cold stimuli. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,303,314 E839G possibly damaging Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
4932438A13Rik T A 3: 36,917,660 F514Y probably benign Het
Adgrf3 T A 5: 30,197,306 T575S probably damaging Het
Akap9 T A 5: 3,971,926 C1158S probably benign Het
Arhgap39 A G 15: 76,726,633 F926L probably damaging Het
BC035947 G T 1: 78,497,930 T655K probably benign Het
Bcas1 T C 2: 170,406,810 T64A probably benign Het
Brca2 A G 5: 150,540,904 K1378E probably benign Het
Card6 A T 15: 5,100,953 N320K probably damaging Het
Ccdc3 A T 2: 5,138,060 I43F probably damaging Het
Cd200r1 T C 16: 44,790,164 S212P probably damaging Het
Col25a1 A G 3: 130,564,154 E477G probably damaging Het
Cpne5 A T 17: 29,184,017 C215S possibly damaging Het
Crim1 T A 17: 78,374,083 S989T possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dync1h1 T A 12: 110,616,404 N340K probably benign Het
Eif4e2 G A 1: 87,226,238 probably null Het
Ephb6 G T 6: 41,619,704 R895L possibly damaging Het
Esrrg T A 1: 188,150,198 H217Q probably benign Het
Fgl1 T A 8: 41,200,557 K100* probably null Het
Flt4 T C 11: 49,630,603 V450A probably benign Het
G6pc2 A T 2: 69,220,784 I74L probably benign Het
Gabrr1 T C 4: 33,161,684 M336T probably damaging Het
Gli1 T A 10: 127,337,436 T118S probably benign Het
Gm5435 A T 12: 82,496,026 noncoding transcript Het
Got1l1 A G 8: 27,198,059 L314P probably damaging Het
Hk3 T A 13: 55,006,813 I740F probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Igsf9b A G 9: 27,324,179 T508A probably damaging Het
Il16 T A 7: 83,648,728 N431I probably benign Het
Lax1 G A 1: 133,680,176 P276S probably damaging Het
Lrp2 A T 2: 69,511,061 V925E possibly damaging Het
Lrp3 T A 7: 35,203,485 T479S possibly damaging Het
Metrn G A 17: 25,795,217 R212C probably damaging Het
Mlip A C 9: 77,347,693 probably null Het
Mmp24 C T 2: 155,799,777 T175I probably damaging Het
N6amt1 A T 16: 87,354,335 D28V probably damaging Het
Olfr1289 G A 2: 111,484,143 G238R probably damaging Het
Olfr215 T C 6: 116,582,929 T6A probably benign Het
Olfr380 A T 11: 73,453,851 Y120* probably null Het
Olfr472 A G 7: 107,902,912 H65R probably damaging Het
Olfr490 G T 7: 108,286,742 A128E probably damaging Het
Olfr870 T A 9: 20,170,969 I201F possibly damaging Het
Pcdh17 T A 14: 84,532,993 N970K probably damaging Het
Pdzrn3 T C 6: 101,151,428 Y759C probably damaging Het
Pkd2l2 T C 18: 34,425,237 L323P probably damaging Het
Psg21 G T 7: 18,652,258 probably benign Het
Rest T C 5: 77,281,726 V664A probably benign Het
Sco2 G A 15: 89,371,972 R160* probably null Het
Sfswap T A 5: 129,514,818 S300T probably damaging Het
Slc5a10 A T 11: 61,678,566 M329K probably benign Het
Slco1a5 G A 6: 142,236,307 P564S probably damaging Het
Stk38 A G 17: 28,982,129 F191S probably damaging Het
Svep1 T A 4: 58,072,826 Y2161F possibly damaging Het
Tada2a G A 11: 84,079,602 T441M possibly damaging Het
Tg T A 15: 66,688,889 N1033K probably benign Het
Thoc3 A T 13: 54,467,873 I126N probably damaging Het
Tnc T C 4: 64,007,730 probably null Het
Tnc A T 4: 64,008,795 D831E possibly damaging Het
Uhmk1 A T 1: 170,211,218 V100E probably damaging Het
Usp43 G A 11: 67,921,916 probably benign Het
Vmn2r90 A T 17: 17,713,450 Y424F probably benign Het
Vps33a C T 5: 123,547,001 probably null Het
Xirp2 A T 2: 67,482,298 K37I probably damaging Het
Zfp106 A T 2: 120,533,507 probably null Het
Zfp748 A T 13: 67,542,528 C204* probably null Het
Other mutations in Cdh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Cdh8 APN 8 99279690 missense probably damaging 0.99
IGL01377:Cdh8 APN 8 99033389 missense probably damaging 0.99
IGL01845:Cdh8 APN 8 99098954 splice site probably benign
IGL02166:Cdh8 APN 8 99190451 missense probably damaging 1.00
IGL02392:Cdh8 APN 8 99030755 missense probably damaging 0.96
R0007:Cdh8 UTSW 8 99230456 nonsense probably null
R0179:Cdh8 UTSW 8 99111712 missense possibly damaging 0.84
R0196:Cdh8 UTSW 8 99190434 missense probably damaging 0.99
R0220:Cdh8 UTSW 8 99111679 missense probably benign 0.21
R0271:Cdh8 UTSW 8 99111715 missense possibly damaging 0.83
R0592:Cdh8 UTSW 8 99279478 missense probably damaging 1.00
R0612:Cdh8 UTSW 8 99400914 missense probably benign 0.02
R1404:Cdh8 UTSW 8 99279618 missense probably damaging 1.00
R1404:Cdh8 UTSW 8 99279618 missense probably damaging 1.00
R1588:Cdh8 UTSW 8 99190407 missense probably damaging 1.00
R1635:Cdh8 UTSW 8 99031024 missense probably damaging 1.00
R1717:Cdh8 UTSW 8 99030705 missense probably damaging 1.00
R1781:Cdh8 UTSW 8 99190462 splice site probably null
R1781:Cdh8 UTSW 8 99279658 missense probably damaging 0.98
R1862:Cdh8 UTSW 8 99190394 missense probably damaging 1.00
R1895:Cdh8 UTSW 8 99279557 missense possibly damaging 0.84
R1912:Cdh8 UTSW 8 99098870 missense probably damaging 1.00
R2005:Cdh8 UTSW 8 99033471 splice site probably null
R2142:Cdh8 UTSW 8 99111693 missense probably damaging 1.00
R2197:Cdh8 UTSW 8 99196265 missense probably damaging 1.00
R2512:Cdh8 UTSW 8 99400863 missense probably benign 0.05
R3085:Cdh8 UTSW 8 99196386 missense probably benign 0.00
R3436:Cdh8 UTSW 8 99400718 splice site probably benign
R3898:Cdh8 UTSW 8 99171373 missense probably damaging 0.98
R4470:Cdh8 UTSW 8 99416689 unclassified probably benign
R4615:Cdh8 UTSW 8 99279622 missense probably damaging 1.00
R4652:Cdh8 UTSW 8 99024859 missense probably benign
R4666:Cdh8 UTSW 8 99024902 missense possibly damaging 0.71
R4798:Cdh8 UTSW 8 99024926 nonsense probably null
R4871:Cdh8 UTSW 8 99030904 missense probably damaging 1.00
R5170:Cdh8 UTSW 8 99279550 missense probably damaging 1.00
R5406:Cdh8 UTSW 8 99196370 missense probably damaging 1.00
R5564:Cdh8 UTSW 8 99030866 missense possibly damaging 0.57
R6311:Cdh8 UTSW 8 99400895 missense probably damaging 0.99
R6786:Cdh8 UTSW 8 99223947 missense probably benign 0.19
R6855:Cdh8 UTSW 8 99190217 missense probably damaging 0.99
R6950:Cdh8 UTSW 8 99030763 missense probably benign 0.18
R7112:Cdh8 UTSW 8 99196352 missense probably damaging 1.00
R7181:Cdh8 UTSW 8 99098925 missense probably benign
X0022:Cdh8 UTSW 8 99279475 missense probably damaging 1.00
Z1088:Cdh8 UTSW 8 99279502 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGTTATTTGGAGGCCGTC -3'
(R):5'- ATGGATTCAACCGCCAGAAG -3'

Sequencing Primer
(F):5'- GGATGAATGTAGAGTCTCATTCCCTC -3'
(R):5'- GAAGTCTACCTTCTGCCTATAGTG -3'
Posted On2016-11-09