Incidental Mutation 'R5688:Calcr'
List |< first << previous [record 26 of 217] next >> last >|
ID443490
Institutional Source Beutler Lab
Gene Symbol Calcr
Ensembl Gene ENSMUSG00000023964
Gene Namecalcitonin receptor
SynonymsClr
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5688 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location3685680-3764714 bp(-) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) T to A at 3714730 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075644] [ENSMUST00000115622] [ENSMUST00000168592] [ENSMUST00000170266] [ENSMUST00000171613]
Predicted Effect probably null
Transcript: ENSMUST00000075644
SMART Domains Protein: ENSMUSP00000075070
Gene: ENSMUSG00000023964

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 441 5.2e-85 PFAM
Pfam:Dicty_CAR 259 410 5e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115622
SMART Domains Protein: ENSMUSP00000111285
Gene: ENSMUSG00000023964

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 404 1.1e-85 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168592
SMART Domains Protein: ENSMUSP00000130243
Gene: ENSMUSG00000023964

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 404 1.1e-85 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170266
SMART Domains Protein: ENSMUSP00000132124
Gene: ENSMUSG00000023964

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 441 2.2e-84 PFAM
Pfam:Dicty_CAR 257 399 2.5e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171396
Predicted Effect probably null
Transcript: ENSMUST00000171613
SMART Domains Protein: ENSMUSP00000130083
Gene: ENSMUSG00000023964

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 404 1.1e-85 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high affinity receptor for the peptide hormone calcitonin and belongs to a subfamily of seven transmembrane-spanning G protein-coupled receptors. The encoded protein is involved in maintaining calcium homeostasis and in regulating osteoclast-mediated bone resorption. Polymorphisms in this gene have been associated with variations in bone mineral density and onset of osteoporosis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Haploinsufficiency may result in increased bone density due to increased bone formation. Homozygous inactivation may result in embryonic lethality. Mice homozygous for another disruption allele at this locus show a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T A 7: 34,253,991 T449S possibly damaging Het
4931406P16Rik T G 7: 34,284,709 D163A probably damaging Het
Acp7 G A 7: 28,616,495 A222V probably benign Het
Ahnak A G 19: 9,002,519 D389G probably benign Het
Aldh1l2 A T 10: 83,501,925 S559T possibly damaging Het
Alms1 T A 6: 85,599,895 N144K possibly damaging Het
Anp32b T A 4: 46,469,868 probably null Het
Atf7 C T 15: 102,551,509 R57H probably damaging Het
Atp10b A T 11: 43,201,173 H345L probably benign Het
Cacna2d1 A T 5: 16,358,952 I859F probably damaging Het
Cd248 A G 19: 5,069,935 T604A probably benign Het
Cemip C T 7: 83,961,641 V702M probably damaging Het
Cep295 G T 9: 15,331,986 Q469K probably damaging Het
Cntn5 A G 9: 9,748,422 W485R probably damaging Het
Cpe T C 8: 64,609,155 N289S possibly damaging Het
Cyp2j11 G A 4: 96,345,121 R113C probably damaging Het
Dcp1b T C 6: 119,217,911 S531P probably benign Het
Defb7 T G 8: 19,495,151 L15R probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ednrb T C 14: 103,823,395 D198G probably damaging Het
Engase A C 11: 118,487,320 E312A possibly damaging Het
Evl G A 12: 108,673,353 probably null Het
Faf1 C A 4: 109,794,813 Q234K probably damaging Het
Gm5460 C A 14: 34,045,795 N453K possibly damaging Het
Gm7356 T A 17: 14,000,607 I387F possibly damaging Het
Hagh T C 17: 24,850,594 M1T probably null Het
Hars A T 18: 36,772,316 V155E probably damaging Het
Hist1h1c A G 13: 23,739,165 K106R probably damaging Het
Lca5 C A 9: 83,398,566 D394Y probably benign Het
Lmtk3 T C 7: 45,791,410 L280P probably damaging Het
Lrit1 C T 14: 37,062,428 A571V possibly damaging Het
Map4k2 C A 19: 6,346,806 P584H probably damaging Het
Mgst1 T C 6: 138,141,800 probably benign Het
Neb C T 2: 52,196,327 V5245I probably damaging Het
Oas3 T C 5: 120,758,802 N918S probably benign Het
Olfr1155 T A 2: 87,943,208 Q140L probably benign Het
Olfr1204 C T 2: 88,852,679 T243I probably benign Het
Olfr145 A C 9: 37,898,063 I220L possibly damaging Het
Ovch2 A G 7: 107,793,994 L224P probably damaging Het
Patj A T 4: 98,520,810 K34* probably null Het
Pcf11 T A 7: 92,658,808 R717S possibly damaging Het
Plcb1 A T 2: 135,335,480 E577D probably benign Het
Plxnb2 T C 15: 89,158,696 K1497E probably damaging Het
Pyroxd1 C A 6: 142,353,540 L141I probably damaging Het
Rhobtb3 G T 13: 75,872,418 N588K probably benign Het
Rnasel G A 1: 153,753,706 probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shank1 A T 7: 44,354,487 I1868F possibly damaging Het
Skiv2l2 A T 13: 112,873,056 C936* probably null Het
Slc28a3 A T 13: 58,558,649 S593T probably damaging Het
Slc29a4 T C 5: 142,714,098 I168T possibly damaging Het
Slc35f5 C T 1: 125,591,038 P502L probably benign Het
Slco6d1 T C 1: 98,480,768 I463T probably damaging Het
Slk A G 19: 47,620,012 D468G probably benign Het
Spata31d1d G T 13: 59,726,508 P1071Q probably damaging Het
Tert G A 13: 73,639,156 V754I probably damaging Het
Thada T C 17: 84,451,727 T235A probably benign Het
Ttn T C 2: 76,734,128 D28555G probably damaging Het
Ttn T A 2: 76,879,984 probably null Het
Ubqln4 T C 3: 88,565,268 L464P probably damaging Het
Unc45b A T 11: 82,922,817 N350I possibly damaging Het
Vmn2r65 T C 7: 84,940,692 D672G probably benign Het
Zfp947 T A 17: 22,146,085 I203L probably benign Het
Zfp964 T A 8: 69,664,116 H454Q probably benign Het
Other mutations in Calcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Calcr APN 6 3717196 missense probably damaging 1.00
IGL01146:Calcr APN 6 3700144 missense possibly damaging 0.88
IGL02253:Calcr APN 6 3707523 missense probably benign 0.12
IGL02567:Calcr APN 6 3691564 missense probably damaging 1.00
IGL02729:Calcr APN 6 3707595 missense probably benign
IGL03062:Calcr APN 6 3693718 missense probably benign 0.08
R0111:Calcr UTSW 6 3717157 missense probably damaging 1.00
R0561:Calcr UTSW 6 3692630 missense probably damaging 0.99
R1013:Calcr UTSW 6 3692621 missense probably damaging 1.00
R1628:Calcr UTSW 6 3700251 missense possibly damaging 0.53
R2152:Calcr UTSW 6 3687615 missense probably benign 0.03
R2206:Calcr UTSW 6 3717133 missense probably damaging 0.98
R2207:Calcr UTSW 6 3717133 missense probably damaging 0.98
R3403:Calcr UTSW 6 3687604 missense probably benign 0.04
R3781:Calcr UTSW 6 3700193 missense possibly damaging 0.93
R3782:Calcr UTSW 6 3700193 missense possibly damaging 0.93
R3851:Calcr UTSW 6 3693735 missense probably damaging 1.00
R3852:Calcr UTSW 6 3693735 missense probably damaging 1.00
R4190:Calcr UTSW 6 3717106 missense possibly damaging 0.82
R4387:Calcr UTSW 6 3707581 missense probably damaging 0.98
R4402:Calcr UTSW 6 3708484 critical splice donor site probably null
R4403:Calcr UTSW 6 3708484 critical splice donor site probably null
R4494:Calcr UTSW 6 3708484 critical splice donor site probably null
R4495:Calcr UTSW 6 3708484 critical splice donor site probably null
R4745:Calcr UTSW 6 3692576 missense probably damaging 0.99
R4857:Calcr UTSW 6 3708511 missense probably benign 0.29
R4883:Calcr UTSW 6 3714705 missense probably damaging 1.00
R5168:Calcr UTSW 6 3708610 missense probably benign 0.00
R5375:Calcr UTSW 6 3714651 missense probably benign 0.00
R5643:Calcr UTSW 6 3708538 missense probably damaging 1.00
R5644:Calcr UTSW 6 3708538 missense probably damaging 1.00
R5799:Calcr UTSW 6 3707592 missense probably benign 0.13
R5920:Calcr UTSW 6 3722994 missense probably damaging 0.97
R6249:Calcr UTSW 6 3692711 missense possibly damaging 0.49
R6329:Calcr UTSW 6 3687621 missense probably damaging 1.00
R6357:Calcr UTSW 6 3714710 missense probably benign 0.00
R6365:Calcr UTSW 6 3711455 missense probably benign 0.00
R6393:Calcr UTSW 6 3708586 missense probably damaging 0.99
R6547:Calcr UTSW 6 3717177 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACGCTTCAGAAACCCTATTTCC -3'
(R):5'- TCTGAGAAGCCCAACACTTG -3'

Sequencing Primer
(F):5'- TTTTTGTGATTTGGGGTAGCAG -3'
(R):5'- GGAATCTCTCTTTCAGCCTTAAATG -3'
Posted On2016-11-09