Incidental Mutation 'H8562:Mknk2'
ID44357
Institutional Source Beutler Lab
Gene Symbol Mknk2
Ensembl Gene ENSMUSG00000020190
Gene NameMAP kinase-interacting serine/threonine kinase 2
SynonymsMnk2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #H8562 (G3) of strain 604
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80665327-80678112 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 80668934 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003433] [ENSMUST00000197276] [ENSMUST00000198819] [ENSMUST00000199949] [ENSMUST00000200082]
Predicted Effect probably benign
Transcript: ENSMUST00000003433
SMART Domains Protein: ENSMUSP00000003433
Gene: ENSMUSG00000020190

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
S_TKc 36 321 7.09e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197276
SMART Domains Protein: ENSMUSP00000143679
Gene: ENSMUSG00000020190

DomainStartEndE-ValueType
SCOP:d1koba_ 52 118 3e-11 SMART
PDB:2AC3|A 59 118 3e-32 PDB
Blast:S_TKc 71 118 1e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198819
Predicted Effect probably benign
Transcript: ENSMUST00000199949
Predicted Effect probably benign
Transcript: ENSMUST00000200082
SMART Domains Protein: ENSMUSP00000143508
Gene: ENSMUSG00000020190

DomainStartEndE-ValueType
low complexity region 60 70 N/A INTRINSIC
S_TKc 83 368 7.09e-88 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (109/114)
MGI Phenotype FUNCTION: The protein encoded by this gene is a serine/threonine-protein kinase, which is targeted by both the extracellular signal-regulated kinase and p38 mitogen-activated protein kinase pathways. This enzyme targets several substrates including eukaryotic translation initiation factor 4E and mammalian target of rapamycin, which are negatively regulated by its phosphorylation. Null mutant mice do not exhibit developmental or reproductive defects. However, mice null for both this protein and mitogen-activated protein kinase-interacting serine/threonine protein kinase 1 have delayed tumor development in phosphatase and tensin homolog mutant mice, indicating an oncogenic function for this gene in tumor development. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous null mice are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,422,921 K251E probably benign Het
2810021J22Rik T C 11: 58,880,891 C400R probably damaging Het
4930519F16Rik A T X: 103,255,857 noncoding transcript Het
5430402E10Rik G T X: 77,922,734 H117Q probably damaging Het
Abca15 T C 7: 120,374,854 probably benign Het
Abca8a A G 11: 110,043,009 I1190T probably benign Het
Acmsd T C 1: 127,749,058 Y107H probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Aff2 G A X: 69,848,926 A939T unknown Het
Ampd2 C A 3: 108,081,111 A11S probably benign Het
Aoah T A 13: 20,816,524 C43S probably damaging Het
Apobec4 T C 1: 152,757,174 S318P probably damaging Het
Arid2 C T 15: 96,369,546 P636S possibly damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Bco1 G T 8: 117,105,647 probably benign Het
Brd3 C T 2: 27,450,533 G555S possibly damaging Het
Brd4 A T 17: 32,229,403 probably benign Het
Btbd7 A G 12: 102,788,302 V735A probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Carmil1 A G 13: 24,064,647 V485A probably benign Het
Casz1 T C 4: 148,933,451 L113P probably damaging Het
Ccdc3 T C 2: 5,138,205 L91S probably damaging Het
Cd180 A G 13: 102,705,418 K324R probably benign Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Cops7a A G 6: 124,962,453 probably benign Het
Cyp2c29 A T 19: 39,309,662 N217I probably damaging Het
Dapk1 C A 13: 60,761,312 H1246Q probably damaging Het
Dmbt1 T A 7: 131,112,076 C1450* probably null Het
Dnah10 T A 5: 124,829,529 M4151K probably damaging Het
Dnaic1 C A 4: 41,629,833 F452L possibly damaging Het
Dync1h1 T C 12: 110,616,807 M446T probably benign Het
Dytn A C 1: 63,674,912 S143A possibly damaging Het
E130308A19Rik T A 4: 59,691,033 L289Q possibly damaging Het
Efemp2 G T 19: 5,480,649 V250L probably benign Het
Elmo1 T C 13: 20,280,863 S201P probably damaging Het
Fam208b A T 13: 3,577,000 S983R probably damaging Het
Fam222b T A 11: 78,154,578 C194S probably damaging Het
Fam91a1 G A 15: 58,427,121 probably null Het
Fcf1 T A 12: 84,980,612 probably benign Het
Fnip1 T A 11: 54,480,297 F134L probably damaging Het
Fyn T C 10: 39,511,954 S69P probably benign Het
Gabbr1 T C 17: 37,071,949 Y845H probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm13083 T A 4: 143,615,350 probably benign Het
Gm1966 A G 7: 106,603,149 F296S probably damaging Het
Gm5435 T C 12: 82,495,675 noncoding transcript Het
Gm7251 A G 13: 49,805,672 Y94H probably damaging Het
Heatr1 T A 13: 12,408,713 N530K probably benign Het
Hist1h2bn T C 13: 21,754,478 V119A probably benign Het
Icam5 A T 9: 21,035,146 E355V probably benign Het
Ighv3-6 A G 12: 114,288,538 probably benign Het
Intu T C 3: 40,692,673 S659P probably damaging Het
Ivns1abp T C 1: 151,354,695 V198A probably damaging Het
Katnb1 T A 8: 95,095,510 probably benign Het
Kcna5 T C 6: 126,533,423 S581G probably damaging Het
Kif23 A G 9: 61,924,065 V741A probably benign Het
Lbr A T 1: 181,820,668 probably benign Het
Loxhd1 A C 18: 77,341,931 T508P possibly damaging Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Ly96 A T 1: 16,691,694 K41N probably damaging Het
Lypd1 C T 1: 125,910,537 probably benign Het
Macf1 A G 4: 123,466,040 V1817A probably benign Het
Mmp19 A T 10: 128,795,601 I117L probably benign Het
Mmrn1 G A 6: 60,958,180 G220D probably damaging Het
Mtrr T C 13: 68,564,377 H630R probably damaging Het
Nfat5 T C 8: 107,339,382 probably benign Het
Ngef C A 1: 87,487,807 K288N possibly damaging Het
Nkain4 T C 2: 180,943,145 E71G probably benign Het
Odc1 T C 12: 17,548,037 Y122H probably benign Het
Olfr384 T C 11: 73,603,447 I289T probably damaging Het
Olfr715 C A 7: 107,129,241 A51S probably benign Het
Olfr919 C A 9: 38,697,910 G156V probably damaging Het
Osbpl3 A T 6: 50,347,466 N190K probably benign Het
Osgepl1 T C 1: 53,315,039 V54A probably damaging Het
Otogl T C 10: 107,910,956 Y19C probably benign Het
Pop1 T C 15: 34,530,212 S919P probably benign Het
Prl8a9 A G 13: 27,562,601 probably benign Het
Prr14l A T 5: 32,793,728 V1907D probably damaging Het
Ptprn T C 1: 75,254,620 T547A possibly damaging Het
Rdh14 G T 12: 10,394,709 V187F probably damaging Het
Rev1 A G 1: 38,056,767 L853P probably damaging Het
Robo4 T C 9: 37,405,810 probably benign Het
Ryr2 A G 13: 11,717,141 probably benign Het
Sec16a G A 2: 26,441,505 P166L probably benign Het
Slc6a19 G A 13: 73,700,124 probably benign Het
Slco4c1 T A 1: 96,842,485 T285S probably benign Het
Speg G T 1: 75,415,597 A1633S probably benign Het
Srpk1 T A 17: 28,602,733 T236S probably benign Het
Stxbp5 T C 10: 9,769,443 N262S probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Syk A G 13: 52,640,621 N441D probably damaging Het
Syt17 T C 7: 118,408,069 K334R probably benign Het
Sytl5 A T X: 9,960,096 H436L probably benign Het
Thada A G 17: 84,446,544 L333P probably damaging Het
Thap12 T C 7: 98,715,107 Y161H probably damaging Het
Thbs2 C T 17: 14,671,453 V941I probably benign Het
Tktl1 A T X: 74,181,864 E72V probably damaging Het
Tm4sf5 T A 11: 70,505,512 probably benign Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vcp T A 4: 42,982,596 I699F probably damaging Het
Vmn1r232 T C 17: 20,913,394 T315A probably benign Het
Vmn2r100 T A 17: 19,521,490 W155R possibly damaging Het
Vmn2r19 T C 6: 123,315,902 I301T possibly damaging Het
Wwc2 A G 8: 47,920,666 V55A possibly damaging Het
Xirp2 A G 2: 67,515,457 T2681A probably benign Het
Zfp39 C A 11: 58,900,686 L58F probably damaging Het
Zfp612 T C 8: 110,090,038 F587L probably damaging Het
Zfp810 T C 9: 22,279,091 R174G probably benign Het
Other mutations in Mknk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Mknk2 APN 10 80667664 splice site probably benign
IGL02471:Mknk2 APN 10 80668121 missense probably damaging 0.99
IGL02643:Mknk2 APN 10 80668601 missense probably damaging 1.00
IGL03052:Mknk2 UTSW 10 80669662 missense probably benign 0.12
R0645:Mknk2 UTSW 10 80671908 unclassified probably null
R2061:Mknk2 UTSW 10 80671557 critical splice donor site probably null
R2105:Mknk2 UTSW 10 80668601 missense possibly damaging 0.90
R2167:Mknk2 UTSW 10 80668701 missense probably damaging 1.00
R3847:Mknk2 UTSW 10 80667975 nonsense probably null
R4649:Mknk2 UTSW 10 80669339 missense probably damaging 1.00
R5062:Mknk2 UTSW 10 80671769 missense probably damaging 1.00
R5358:Mknk2 UTSW 10 80671763 missense probably benign 0.19
R5433:Mknk2 UTSW 10 80667225 missense probably benign 0.00
R5518:Mknk2 UTSW 10 80668641 missense possibly damaging 0.92
R5813:Mknk2 UTSW 10 80675862 missense probably benign 0.34
R6060:Mknk2 UTSW 10 80671634 missense probably benign 0.00
R6151:Mknk2 UTSW 10 80669025 unclassified probably null
R6366:Mknk2 UTSW 10 80671933 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCGTAGATGCTGGCCTCTTCACTG -3'
(R):5'- AGAGAACATCCTATGTGAGCACCCC -3'

Sequencing Primer
(F):5'- TCAGAAGGGATGCCAGCTC -3'
(R):5'- AGGTGAGGCTGCCTGAC -3'
Posted On2013-06-11