Incidental Mutation 'R5690:C1s2'
ID443623
Institutional Source Beutler Lab
Gene Symbol C1s2
Ensembl Gene ENSMUSG00000079343
Gene Namecomplement component 1, s subcomponent 2
SynonymsGm5077
MMRRC Submission 043323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R5690 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124624625-124636085 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124631037 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 233 (N233S)
Ref Sequence ENSEMBL: ENSMUSP00000066999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068797] [ENSMUST00000218020]
Predicted Effect probably benign
Transcript: ENSMUST00000068797
AA Change: N233S

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000066999
Gene: ENSMUSG00000079343
AA Change: N233S

DomainStartEndE-ValueType
CUB 15 136 1.31e-28 SMART
EGF_CA 137 178 3.35e-7 SMART
CUB 181 296 1.45e-30 SMART
CCP 300 360 3.27e-6 SMART
CCP 365 427 9.54e-8 SMART
Tryp_SPc 443 681 8.92e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204754
AA Change: N239S
SMART Domains Protein: ENSMUSP00000145029
Gene: ENSMUSG00000107554
AA Change: N239S

DomainStartEndE-ValueType
CUB 15 136 1.31e-28 SMART
EGF_CA 137 178 3.35e-7 SMART
CUB 181 296 1.45e-30 SMART
CCP 300 360 3.27e-6 SMART
CCP 365 427 9.54e-8 SMART
Tryp_SPc 443 681 8.92e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218020
AA Change: N239S

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008F13Rik G A 2: 156,865,314 V58I probably benign Het
2810474O19Rik T C 6: 149,328,237 L927S possibly damaging Het
4930533K18Rik A G 10: 70,923,314 probably benign Het
Acadl T C 1: 66,853,286 Y126C probably damaging Het
Ak6 A G 13: 100,655,621 probably null Het
Ap1s1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 5: 137,037,379 probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp6v1e1 A T 6: 120,808,356 probably null Het
Axin1 A G 17: 26,194,937 Y792C probably damaging Het
Ccer2 C A 7: 28,756,204 probably benign Het
Cfap46 A G 7: 139,638,353 S1481P probably benign Het
Cspg4 A T 9: 56,898,735 T2277S probably benign Het
Ctsl T A 13: 64,365,208 N300I probably damaging Het
Dnah2 T C 11: 69,491,544 I1247V probably benign Het
Dsg3 A T 18: 20,522,051 Q135L probably benign Het
Efcab14 G A 4: 115,760,047 V318M possibly damaging Het
Etl4 G A 2: 20,805,836 S910N probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frmd4b T C 6: 97,353,203 E133G possibly damaging Het
Herc2 T C 7: 56,157,705 F2514S probably benign Het
Il18rap A G 1: 40,537,112 D261G possibly damaging Het
Klk1b16 A G 7: 44,140,894 probably null Het
Lrp1b A C 2: 40,750,894 probably null Het
Mrpl45 C A 11: 97,321,586 probably benign Het
Myh13 A G 11: 67,329,275 E150G probably damaging Het
Nbas T A 12: 13,336,284 V737D probably damaging Het
Ncr1 T C 7: 4,338,297 Y59H probably damaging Het
Nt5c1a T A 4: 123,215,939 V277E probably damaging Het
Ogfod1 T A 8: 94,058,141 S343T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pnpla1 A T 17: 28,878,372 I171F probably damaging Het
Rdh8 A G 9: 20,825,489 N259S probably damaging Het
Slc22a12 A G 19: 6,536,848 M496T probably benign Het
Slc8b1 G A 5: 120,513,205 W10* probably null Het
Smarcc2 G A 10: 128,484,407 G887S probably damaging Het
Smc1b A G 15: 85,112,773 S549P probably damaging Het
Synj2 A G 17: 6,035,527 M1181V probably benign Het
Tbx15 T C 3: 99,308,850 S76P probably damaging Het
Tbx2 A T 11: 85,837,053 I271F probably damaging Het
Thap4 A G 1: 93,716,630 probably null Het
Tmc2 A G 2: 130,232,386 Y333C probably damaging Het
Trcg1 C T 9: 57,241,811 P222L probably benign Het
Tubb3 T C 8: 123,421,306 V326A probably benign Het
Unc80 A C 1: 66,640,572 I2101L probably benign Het
Vmn1r19 T C 6: 57,404,795 L111S probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Xpo4 T C 14: 57,590,989 I805V probably benign Het
Other mutations in C1s2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01503:C1s2 APN 6 124625653 missense probably damaging 0.99
IGL02112:C1s2 APN 6 124625308 missense probably benign 0.28
IGL02342:C1s2 APN 6 124632116 missense probably damaging 0.98
R0616:C1s2 UTSW 6 124628764 missense probably damaging 1.00
R0621:C1s2 UTSW 6 124631112 missense probably damaging 1.00
R1439:C1s2 UTSW 6 124630167 splice site probably benign
R1451:C1s2 UTSW 6 124625494 missense probably benign 0.06
R1484:C1s2 UTSW 6 124625645 missense possibly damaging 0.95
R1570:C1s2 UTSW 6 124625764 missense probably benign 0.01
R1824:C1s2 UTSW 6 124635682 missense probably benign 0.03
R2009:C1s2 UTSW 6 124635089 missense probably damaging 1.00
R2109:C1s2 UTSW 6 124635045 missense probably damaging 0.96
R2197:C1s2 UTSW 6 124632110 missense probably damaging 1.00
R4421:C1s2 UTSW 6 124625215 missense probably benign 0.39
R4573:C1s2 UTSW 6 124628243 intron probably null
R4906:C1s2 UTSW 6 124635114 nonsense probably null
R4923:C1s2 UTSW 6 124625690 missense probably benign 0.00
R4977:C1s2 UTSW 6 124635639 missense probably damaging 0.96
R5030:C1s2 UTSW 6 124635588 missense possibly damaging 0.77
R5708:C1s2 UTSW 6 124625743 nonsense probably null
R5846:C1s2 UTSW 6 124631164 missense probably damaging 1.00
R6176:C1s2 UTSW 6 124625809 missense probably damaging 1.00
R6177:C1s2 UTSW 6 124630001 missense probably damaging 0.96
R6842:C1s2 UTSW 6 124627502 missense probably benign 0.12
X0062:C1s2 UTSW 6 124635090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACATAGCAAAGCCCTGGC -3'
(R):5'- AACTGTAGTGGAGATGTGTTCAC -3'

Sequencing Primer
(F):5'- CCCTGGCTTAAGGAAGGAGC -3'
(R):5'- GGAGATGTGTTCACTGCCC -3'
Posted On2016-11-09