Incidental Mutation 'R5691:Fan1'
ID443686
Institutional Source Beutler Lab
Gene Symbol Fan1
Ensembl Gene ENSMUSG00000033458
Gene NameFANCD2/FANCI-associated nuclease 1
SynonymsMtmr15
MMRRC Submission 043324-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5691 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location64346758-64374095 bp(-) (GRCm38)
Type of Mutationunclassified (1 bp from exon)
DNA Base Change (assembly) C to A at 64354370 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000163289]
Predicted Effect probably null
Transcript: ENSMUST00000163289
SMART Domains Protein: ENSMUSP00000130012
Gene: ENSMUSG00000033458

DomainStartEndE-ValueType
SCOP:d1ihga1 600 737 5e-5 SMART
Blast:VRR_NUC 834 867 2e-12 BLAST
VRR_NUC 896 1011 1.99e-37 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177443
SMART Domains Protein: ENSMUSP00000135335
Gene: ENSMUSG00000033458

DomainStartEndE-ValueType
SCOP:d1ihga1 600 737 5e-5 SMART
Blast:VRR_NUC 834 867 2e-12 BLAST
VRR_NUC 896 1011 1.99e-37 SMART
Meta Mutation Damage Score 0.418 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene plays a role in DNA interstrand cross-link repair and encodes a protein with 5' flap endonuclease and 5'-3' exonuclease activity. Mutations in this gene cause karyomegalic interstitial nephritis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for mutations in this gene display renal tubular karyomegaly with polyploidy and defects in interstrand cross-link DNA repair. Some homozygous mice also display hepatocyte karyomegaly and liver dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410022M11Rik A G 14: 56,812,373 probably benign Het
Abcb5 A T 12: 118,927,235 M509K probably damaging Het
Ap4m1 A G 5: 138,172,391 Y34C probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Bcl10 C T 3: 145,933,149 T182I probably benign Het
Cdc123 T A 2: 5,823,175 N87I probably benign Het
Cfap46 T C 7: 139,606,700 E2431G possibly damaging Het
Dcc T C 18: 71,575,083 T521A probably damaging Het
Defb46 T A 8: 19,242,133 I55K probably benign Het
Dlgap4 A G 2: 156,704,470 T353A probably benign Het
Eqtn C A 4: 94,923,728 probably null Het
Ermn A T 2: 58,047,764 M279K probably damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Gm13084 A T 4: 143,812,009 W131R probably benign Het
Gm6614 A T 6: 141,994,855 Y93* probably null Het
Gm9745 A T 13: 8,942,657 Y91* probably null Het
Hectd4 A G 5: 121,348,815 D3291G possibly damaging Het
Hid1 A G 11: 115,348,819 W762R probably damaging Het
Ifi207 A G 1: 173,732,426 I160T unknown Het
Inpp4b T A 8: 81,890,694 probably benign Het
Iqcd C T 5: 120,602,506 Q301* probably null Het
Jph1 T G 1: 17,004,363 Q477P probably benign Het
Kdm4c A T 4: 74,334,728 I511L probably benign Het
Lrp2 T C 2: 69,502,553 D1540G probably damaging Het
Lrrc69 T A 4: 14,769,648 I168F probably damaging Het
Mgat4e A T 1: 134,540,991 probably benign Het
Mroh7 C A 4: 106,702,618 G704V probably damaging Het
Nadsyn1 C T 7: 143,812,579 probably null Het
Ncoa2 A T 1: 13,180,550 C303S probably damaging Het
Nova1 T C 12: 46,816,955 T71A unknown Het
Nrcam T C 12: 44,564,256 Y554H probably damaging Het
Nubpl G A 12: 52,105,276 probably benign Het
Oasl2 C A 5: 114,899,767 T75K possibly damaging Het
Olfr1099 A T 2: 86,959,272 F62Y probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Parp14 A G 16: 35,863,539 V139A probably benign Het
Pgam5 G A 5: 110,267,093 P85S probably damaging Het
Phpt1 T C 2: 25,573,695 Y96C probably damaging Het
Plekhm2 A C 4: 141,628,289 S867A possibly damaging Het
Prss21 A G 17: 23,868,785 probably null Het
Rabgap1l A T 1: 160,735,684 Y108N probably damaging Het
Riox1 C T 12: 83,951,692 T334I possibly damaging Het
Rps3a2 G T 14: 88,123,047 noncoding transcript Het
Selenot C T 3: 58,586,026 A108V probably benign Het
Setd3 A T 12: 108,160,285 M98K probably benign Het
Slc22a27 T C 19: 7,926,670 H34R possibly damaging Het
Sp3 A G 2: 72,971,459 L70S probably damaging Het
Syne2 TCCAGGTAGGGCACACC TCC 12: 76,027,856 probably null Het
Tcl1b4 C A 12: 105,202,547 D23E possibly damaging Het
Tespa1 T A 10: 130,354,769 probably null Het
Tmc7 T C 7: 118,541,893 I672V probably benign Het
Trps1 T A 15: 50,827,304 Q14L probably benign Het
Vmn2r73 A G 7: 85,858,091 V671A probably damaging Het
Zfp106 G A 2: 120,524,471 S1273F probably damaging Het
Zfp90 C A 8: 106,425,078 Y474* probably null Het
Other mutations in Fan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01648:Fan1 APN 7 64372549 missense probably damaging 0.96
IGL01752:Fan1 APN 7 64372794 missense probably benign 0.00
IGL01971:Fan1 APN 7 64353711 missense probably damaging 0.98
IGL02043:Fan1 APN 7 64371619 unclassified probably null
IGL02542:Fan1 APN 7 64364660 missense probably damaging 1.00
IGL02731:Fan1 APN 7 64372993 missense possibly damaging 0.86
IGL03111:Fan1 APN 7 64350068 missense possibly damaging 0.67
hitched UTSW 7 64364629 missense probably damaging 1.00
stitched UTSW 7 64372486 missense probably damaging 0.97
R0270:Fan1 UTSW 7 64348871 missense probably benign 0.26
R0632:Fan1 UTSW 7 64363199 missense possibly damaging 0.50
R1714:Fan1 UTSW 7 64366687 missense probably benign 0.29
R1750:Fan1 UTSW 7 64373013 missense probably benign 0.14
R1822:Fan1 UTSW 7 64372806 missense probably benign 0.00
R2031:Fan1 UTSW 7 64354424 missense probably damaging 0.98
R2107:Fan1 UTSW 7 64366788 missense probably damaging 1.00
R2126:Fan1 UTSW 7 64346888 missense probably damaging 1.00
R2869:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2869:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2870:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2870:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2871:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2871:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2873:Fan1 UTSW 7 64363190 missense probably benign 0.16
R3849:Fan1 UTSW 7 64372371 missense probably damaging 1.00
R3850:Fan1 UTSW 7 64372371 missense probably damaging 1.00
R3949:Fan1 UTSW 7 64371544 nonsense probably null
R4007:Fan1 UTSW 7 64366561 missense probably damaging 1.00
R4490:Fan1 UTSW 7 64369180 missense possibly damaging 0.84
R4623:Fan1 UTSW 7 64373553 nonsense probably null
R4918:Fan1 UTSW 7 64373538 utr 5 prime probably benign
R5328:Fan1 UTSW 7 64354469 missense probably damaging 1.00
R5902:Fan1 UTSW 7 64373322 unclassified probably null
R5905:Fan1 UTSW 7 64353651 missense probably benign 0.00
R6126:Fan1 UTSW 7 64364570 nonsense probably null
R6195:Fan1 UTSW 7 64354371 missense probably damaging 1.00
R6233:Fan1 UTSW 7 64354371 missense probably damaging 1.00
R6405:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6434:Fan1 UTSW 7 64354381 missense probably damaging 0.99
R6460:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6469:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6471:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6473:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6696:Fan1 UTSW 7 64350078 missense probably damaging 1.00
R6708:Fan1 UTSW 7 64372806 missense probably benign 0.00
R6713:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6714:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6749:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6841:Fan1 UTSW 7 64364629 missense probably damaging 1.00
R6858:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6859:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6860:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6925:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6927:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6936:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6938:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6939:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7040:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7120:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7290:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7292:Fan1 UTSW 7 64372486 missense probably damaging 0.97
X0025:Fan1 UTSW 7 64372835 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGACACCGCTATCCCAAATGAG -3'
(R):5'- AAGTAAATTGACAGCTGCTGC -3'

Sequencing Primer
(F):5'- CCGCTATCCCAAATGAGAATCAG -3'
(R):5'- ACATGTGACTTGTTAATTGCTAGGC -3'
Posted On2016-11-09