Incidental Mutation 'R5691:Hid1'
ID443696
Institutional Source Beutler Lab
Gene Symbol Hid1
Ensembl Gene ENSMUSG00000034586
Gene NameHID1 domain containing
SynonymsC630004H02Rik
MMRRC Submission 043324-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R5691 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115347707-115367756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115348819 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 762 (W762R)
Ref Sequence ENSEMBL: ENSMUSP00000102152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019006] [ENSMUST00000044152] [ENSMUST00000106542] [ENSMUST00000106543]
Predicted Effect probably benign
Transcript: ENSMUST00000019006
SMART Domains Protein: ENSMUSP00000019006
Gene: ENSMUSG00000018862

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 102 120 N/A INTRINSIC
Pfam:Otopetrin 142 483 3e-40 PFAM
Pfam:Otopetrin 506 583 1.2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000044152
AA Change: W761R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043789
Gene: ENSMUSG00000034586
AA Change: W761R

DomainStartEndE-ValueType
Pfam:Dymeclin 1 763 3.9e-242 PFAM
Pfam:Hid1 1 784 3.1e-260 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106542
AA Change: W762R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102152
Gene: ENSMUSG00000034586
AA Change: W762R

DomainStartEndE-ValueType
Pfam:Dymeclin 1 764 7.5e-275 PFAM
Pfam:Hid1 1 785 2.3e-261 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106543
SMART Domains Protein: ENSMUSP00000102153
Gene: ENSMUSG00000018862

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 102 120 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 178 195 N/A INTRINSIC
transmembrane domain 208 227 N/A INTRINSIC
Pfam:Otopetrin 241 462 2.1e-20 PFAM
Pfam:Otopetrin 487 564 2.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146256
Meta Mutation Damage Score 0.528 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410022M11Rik A G 14: 56,812,373 probably benign Het
Abcb5 A T 12: 118,927,235 M509K probably damaging Het
Ap4m1 A G 5: 138,172,391 Y34C probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Bcl10 C T 3: 145,933,149 T182I probably benign Het
Cdc123 T A 2: 5,823,175 N87I probably benign Het
Cfap46 T C 7: 139,606,700 E2431G possibly damaging Het
Dcc T C 18: 71,575,083 T521A probably damaging Het
Defb46 T A 8: 19,242,133 I55K probably benign Het
Dlgap4 A G 2: 156,704,470 T353A probably benign Het
Eqtn C A 4: 94,923,728 probably null Het
Ermn A T 2: 58,047,764 M279K probably damaging Het
Fan1 C A 7: 64,354,370 probably null Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Gm13084 A T 4: 143,812,009 W131R probably benign Het
Gm6614 A T 6: 141,994,855 Y93* probably null Het
Gm9745 A T 13: 8,942,657 Y91* probably null Het
Hectd4 A G 5: 121,348,815 D3291G possibly damaging Het
Ifi207 A G 1: 173,732,426 I160T unknown Het
Inpp4b T A 8: 81,890,694 probably benign Het
Iqcd C T 5: 120,602,506 Q301* probably null Het
Jph1 T G 1: 17,004,363 Q477P probably benign Het
Kdm4c A T 4: 74,334,728 I511L probably benign Het
Lrp2 T C 2: 69,502,553 D1540G probably damaging Het
Lrrc69 T A 4: 14,769,648 I168F probably damaging Het
Mgat4e A T 1: 134,540,991 probably benign Het
Mroh7 C A 4: 106,702,618 G704V probably damaging Het
Nadsyn1 C T 7: 143,812,579 probably null Het
Ncoa2 A T 1: 13,180,550 C303S probably damaging Het
Nova1 T C 12: 46,816,955 T71A unknown Het
Nrcam T C 12: 44,564,256 Y554H probably damaging Het
Nubpl G A 12: 52,105,276 probably benign Het
Oasl2 C A 5: 114,899,767 T75K possibly damaging Het
Olfr1099 A T 2: 86,959,272 F62Y probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Parp14 A G 16: 35,863,539 V139A probably benign Het
Pgam5 G A 5: 110,267,093 P85S probably damaging Het
Phpt1 T C 2: 25,573,695 Y96C probably damaging Het
Plekhm2 A C 4: 141,628,289 S867A possibly damaging Het
Prss21 A G 17: 23,868,785 probably null Het
Rabgap1l A T 1: 160,735,684 Y108N probably damaging Het
Riox1 C T 12: 83,951,692 T334I possibly damaging Het
Rps3a2 G T 14: 88,123,047 noncoding transcript Het
Selenot C T 3: 58,586,026 A108V probably benign Het
Setd3 A T 12: 108,160,285 M98K probably benign Het
Slc22a27 T C 19: 7,926,670 H34R possibly damaging Het
Sp3 A G 2: 72,971,459 L70S probably damaging Het
Syne2 TCCAGGTAGGGCACACC TCC 12: 76,027,856 probably null Het
Tcl1b4 C A 12: 105,202,547 D23E possibly damaging Het
Tespa1 T A 10: 130,354,769 probably null Het
Tmc7 T C 7: 118,541,893 I672V probably benign Het
Trps1 T A 15: 50,827,304 Q14L probably benign Het
Vmn2r73 A G 7: 85,858,091 V671A probably damaging Het
Zfp106 G A 2: 120,524,471 S1273F probably damaging Het
Zfp90 C A 8: 106,425,078 Y474* probably null Het
Other mutations in Hid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Hid1 APN 11 115359069 missense probably benign 0.05
IGL00783:Hid1 APN 11 115348510 missense probably damaging 1.00
IGL00935:Hid1 APN 11 115348498 missense probably damaging 1.00
IGL02081:Hid1 APN 11 115348506 missense possibly damaging 0.94
IGL02383:Hid1 APN 11 115352620 missense probably damaging 1.00
IGL02637:Hid1 APN 11 115350595 missense probably damaging 0.97
IGL03174:Hid1 APN 11 115360389 missense probably damaging 1.00
R0124:Hid1 UTSW 11 115356823 missense probably damaging 1.00
R0533:Hid1 UTSW 11 115348809 missense probably damaging 1.00
R1027:Hid1 UTSW 11 115355425 missense probably damaging 1.00
R1069:Hid1 UTSW 11 115356765 missense probably damaging 1.00
R1171:Hid1 UTSW 11 115352717 missense probably benign
R1583:Hid1 UTSW 11 115356750 missense possibly damaging 0.51
R1689:Hid1 UTSW 11 115360357 missense probably damaging 1.00
R1746:Hid1 UTSW 11 115354638 missense probably damaging 0.98
R1772:Hid1 UTSW 11 115348473 missense probably damaging 0.97
R1773:Hid1 UTSW 11 115348510 missense probably damaging 1.00
R1831:Hid1 UTSW 11 115348903 missense probably damaging 1.00
R2234:Hid1 UTSW 11 115351119 missense probably damaging 1.00
R2235:Hid1 UTSW 11 115351119 missense probably damaging 1.00
R2897:Hid1 UTSW 11 115350530 missense probably benign
R2898:Hid1 UTSW 11 115350530 missense probably benign
R3711:Hid1 UTSW 11 115358775 missense probably damaging 1.00
R4059:Hid1 UTSW 11 115356739 missense probably damaging 1.00
R4394:Hid1 UTSW 11 115367642 utr 5 prime probably benign
R4478:Hid1 UTSW 11 115361655 missense probably damaging 1.00
R4552:Hid1 UTSW 11 115358679 missense possibly damaging 0.94
R4822:Hid1 UTSW 11 115355299 missense probably damaging 1.00
R5980:Hid1 UTSW 11 115350948 missense possibly damaging 0.64
R5981:Hid1 UTSW 11 115350948 missense possibly damaging 0.64
R6363:Hid1 UTSW 11 115352596 missense probably damaging 1.00
R6577:Hid1 UTSW 11 115354636 missense possibly damaging 0.89
R7191:Hid1 UTSW 11 115348469 makesense probably null
R7307:Hid1 UTSW 11 115348482 missense probably damaging 1.00
X0025:Hid1 UTSW 11 115348803 nonsense probably null
X0066:Hid1 UTSW 11 115354725 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTCTGGGTAATGAGTGCC -3'
(R):5'- GTGAGTCCAGAAGCTGTCCATG -3'

Sequencing Primer
(F):5'- TAATGAGTGCCCACCCTCG -3'
(R):5'- CCAGAAGCTGTCCATGGAGGG -3'
Posted On2016-11-09