Incidental Mutation 'R5691:Dcc'
ID443711
Institutional Source Beutler Lab
Gene Symbol Dcc
Ensembl Gene ENSMUSG00000060534
Gene Namedeleted in colorectal carcinoma
SynonymsC030036D22Rik, Igdcc1
MMRRC Submission 043324-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5691 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location71258738-72351069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71575083 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 521 (T521A)
Ref Sequence ENSEMBL: ENSMUSP00000110593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073379] [ENSMUST00000114943]
Predicted Effect probably damaging
Transcript: ENSMUST00000073379
AA Change: T521A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073094
Gene: ENSMUSG00000060534
AA Change: T521A

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
IG 46 137 9.12e-7 SMART
IGc2 152 219 1.75e-17 SMART
IGc2 252 317 4.12e-14 SMART
IGc2 343 407 8e-12 SMART
IG_like 424 520 1.06e2 SMART
FN3 429 511 6.69e-12 SMART
FN3 528 607 6.53e-15 SMART
FN3 622 705 2.09e-13 SMART
FN3 726 805 8.43e-9 SMART
FN3 824 909 2.48e-6 SMART
FN3 925 1011 1.35e-7 SMART
transmembrane domain 1079 1101 N/A INTRINSIC
Pfam:Neogenin_C 1126 1425 5.5e-129 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114943
AA Change: T521A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110593
Gene: ENSMUSG00000060534
AA Change: T521A

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
IG 46 137 9.12e-7 SMART
IGc2 152 219 1.75e-17 SMART
IGc2 252 317 4.12e-14 SMART
IGc2 343 407 8e-12 SMART
IG_like 424 520 1.06e2 SMART
FN3 429 511 6.69e-12 SMART
FN3 528 607 6.53e-15 SMART
FN3 622 705 2.09e-13 SMART
FN3 726 805 8.43e-9 SMART
FN3 844 929 2.48e-6 SMART
FN3 945 1031 1.35e-7 SMART
transmembrane domain 1099 1121 N/A INTRINSIC
Pfam:Neogenin_C 1148 1445 3.4e-113 PFAM
Meta Mutation Damage Score 0.34 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a netrin 1 receptor. The transmembrane protein is a member of the immunoglobulin superfamily of cell adhesion molecules, and mediates axon guidance of neuronal growth cones towards sources of netrin 1 ligand. The cytoplasmic tail interacts with the tyrosine kinases Src and focal adhesion kinase (FAK, also known as PTK2) to mediate axon attraction. The protein partially localizes to lipid rafts, and induces apoptosis in the absence of ligand. The protein functions as a tumor suppressor, and is frequently mutated or downregulated in colorectal cancer and esophageal carcinoma. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous animals show defects in axonal projections and hypothalamic development affecting both visual and neruoendocrine systems. Incidence of tumors increases in mutations preventing netrin-1 binding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410022M11Rik A G 14: 56,812,373 probably benign Het
Abcb5 A T 12: 118,927,235 M509K probably damaging Het
Ap4m1 A G 5: 138,172,391 Y34C probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Bcl10 C T 3: 145,933,149 T182I probably benign Het
Cdc123 T A 2: 5,823,175 N87I probably benign Het
Cfap46 T C 7: 139,606,700 E2431G possibly damaging Het
Defb46 T A 8: 19,242,133 I55K probably benign Het
Dlgap4 A G 2: 156,704,470 T353A probably benign Het
Eqtn C A 4: 94,923,728 probably null Het
Ermn A T 2: 58,047,764 M279K probably damaging Het
Fan1 C A 7: 64,354,370 probably null Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Gm13084 A T 4: 143,812,009 W131R probably benign Het
Gm6614 A T 6: 141,994,855 Y93* probably null Het
Gm9745 A T 13: 8,942,657 Y91* probably null Het
Hectd4 A G 5: 121,348,815 D3291G possibly damaging Het
Hid1 A G 11: 115,348,819 W762R probably damaging Het
Ifi207 A G 1: 173,732,426 I160T unknown Het
Inpp4b T A 8: 81,890,694 probably benign Het
Iqcd C T 5: 120,602,506 Q301* probably null Het
Jph1 T G 1: 17,004,363 Q477P probably benign Het
Kdm4c A T 4: 74,334,728 I511L probably benign Het
Lrp2 T C 2: 69,502,553 D1540G probably damaging Het
Lrrc69 T A 4: 14,769,648 I168F probably damaging Het
Mgat4e A T 1: 134,540,991 probably benign Het
Mroh7 C A 4: 106,702,618 G704V probably damaging Het
Nadsyn1 C T 7: 143,812,579 probably null Het
Ncoa2 A T 1: 13,180,550 C303S probably damaging Het
Nova1 T C 12: 46,816,955 T71A unknown Het
Nrcam T C 12: 44,564,256 Y554H probably damaging Het
Nubpl G A 12: 52,105,276 probably benign Het
Oasl2 C A 5: 114,899,767 T75K possibly damaging Het
Olfr1099 A T 2: 86,959,272 F62Y probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Parp14 A G 16: 35,863,539 V139A probably benign Het
Pgam5 G A 5: 110,267,093 P85S probably damaging Het
Phpt1 T C 2: 25,573,695 Y96C probably damaging Het
Plekhm2 A C 4: 141,628,289 S867A possibly damaging Het
Prss21 A G 17: 23,868,785 probably null Het
Rabgap1l A T 1: 160,735,684 Y108N probably damaging Het
Riox1 C T 12: 83,951,692 T334I possibly damaging Het
Rps3a2 G T 14: 88,123,047 noncoding transcript Het
Selenot C T 3: 58,586,026 A108V probably benign Het
Setd3 A T 12: 108,160,285 M98K probably benign Het
Slc22a27 T C 19: 7,926,670 H34R possibly damaging Het
Sp3 A G 2: 72,971,459 L70S probably damaging Het
Syne2 TCCAGGTAGGGCACACC TCC 12: 76,027,856 probably null Het
Tcl1b4 C A 12: 105,202,547 D23E possibly damaging Het
Tespa1 T A 10: 130,354,769 probably null Het
Tmc7 T C 7: 118,541,893 I672V probably benign Het
Trps1 T A 15: 50,827,304 Q14L probably benign Het
Vmn2r73 A G 7: 85,858,091 V671A probably damaging Het
Zfp106 G A 2: 120,524,471 S1273F probably damaging Het
Zfp90 C A 8: 106,425,078 Y474* probably null Het
Other mutations in Dcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dcc APN 18 71384225 critical splice acceptor site probably null
IGL00781:Dcc APN 18 71809195 missense probably benign 0.25
IGL00818:Dcc APN 18 71955012 missense probably benign
IGL00895:Dcc APN 18 71810800 missense probably damaging 0.98
IGL00969:Dcc APN 18 71456883 missense probably benign 0.25
IGL01019:Dcc APN 18 71809090 missense probably benign 0.00
IGL01132:Dcc APN 18 71682174 nonsense probably null
IGL01349:Dcc APN 18 71370737 missense probably damaging 1.00
IGL01355:Dcc APN 18 71809114 missense probably benign 0.00
IGL01374:Dcc APN 18 71374553 missense probably damaging 1.00
IGL01947:Dcc APN 18 71826209 missense probably benign
IGL02470:Dcc APN 18 71955082 splice site probably benign
IGL02508:Dcc APN 18 71370702 missense probably benign 0.00
IGL02999:Dcc APN 18 71378678 missense possibly damaging 0.68
IGL03034:Dcc APN 18 71575143 nonsense probably null
IGL03118:Dcc APN 18 71420273 missense probably benign 0.00
IGL03133:Dcc APN 18 71262955 splice site probably benign
IGL03357:Dcc APN 18 71327554 missense probably damaging 1.00
Hyperrev UTSW 18 71259015 missense probably damaging 1.00
LCD18:Dcc UTSW 18 72297447 intron probably benign
P0031:Dcc UTSW 18 71384228 splice site probably benign
PIT4142001:Dcc UTSW 18 71384226 splice site probably null
R0076:Dcc UTSW 18 71321046 nonsense probably null
R0355:Dcc UTSW 18 71575208 missense possibly damaging 0.75
R0370:Dcc UTSW 18 71587985 missense possibly damaging 0.92
R0383:Dcc UTSW 18 71420263 missense probably damaging 0.99
R0541:Dcc UTSW 18 71259015 missense probably damaging 1.00
R0690:Dcc UTSW 18 71809204 splice site probably benign
R0762:Dcc UTSW 18 71342705 splice site probably benign
R0765:Dcc UTSW 18 71362990 missense probably damaging 1.00
R0846:Dcc UTSW 18 71826212 missense probably benign 0.06
R1230:Dcc UTSW 18 71682313 missense probably damaging 1.00
R1662:Dcc UTSW 18 71420338 missense probably benign 0.00
R1663:Dcc UTSW 18 71826052 missense probably damaging 1.00
R1697:Dcc UTSW 18 71370737 missense probably damaging 1.00
R1770:Dcc UTSW 18 71446399 missense probably benign 0.01
R1781:Dcc UTSW 18 71378717 missense probably benign 0.41
R1797:Dcc UTSW 18 71367161 missense probably damaging 1.00
R2101:Dcc UTSW 18 71810870 missense possibly damaging 0.62
R2190:Dcc UTSW 18 71547420 missense possibly damaging 0.89
R2248:Dcc UTSW 18 71826168 missense probably benign 0.00
R2262:Dcc UTSW 18 71374551 missense probably damaging 1.00
R2442:Dcc UTSW 18 71456883 missense probably damaging 0.98
R3844:Dcc UTSW 18 71826186 missense probably benign 0.01
R4037:Dcc UTSW 18 72350397 missense possibly damaging 0.57
R4085:Dcc UTSW 18 71826169 missense probably benign 0.00
R4344:Dcc UTSW 18 71374490 missense probably damaging 0.99
R4499:Dcc UTSW 18 71547317 missense probably benign 0.07
R4611:Dcc UTSW 18 71548998 splice site probably null
R4811:Dcc UTSW 18 71299483 missense probably benign 0.31
R4937:Dcc UTSW 18 71542249 nonsense probably null
R5125:Dcc UTSW 18 71456877 missense probably benign 0.02
R5292:Dcc UTSW 18 71306088 missense probably damaging 1.00
R5297:Dcc UTSW 18 71378738 missense probably benign 0.00
R5317:Dcc UTSW 18 71384155 missense possibly damaging 0.78
R5693:Dcc UTSW 18 71575082 missense probably damaging 1.00
R6091:Dcc UTSW 18 71809114 missense probably benign 0.00
R6291:Dcc UTSW 18 71682167 missense probably benign 0.06
R6307:Dcc UTSW 18 71810755 missense probably benign 0.15
R6343:Dcc UTSW 18 71336035 missense probably damaging 1.00
R6508:Dcc UTSW 18 71306073 missense probably damaging 1.00
R6701:Dcc UTSW 18 71809120 missense probably benign 0.02
R6810:Dcc UTSW 18 71370693 missense probably damaging 0.99
R7078:Dcc UTSW 18 71547398 missense probably benign 0.05
R7172:Dcc UTSW 18 71378684 missense probably benign 0.04
W0251:Dcc UTSW 18 71826083 missense probably damaging 1.00
X0020:Dcc UTSW 18 71321100 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAGGATAAGTTGCTTCATAGAAGAG -3'
(R):5'- AGTTTGGGCTAATGCTTTCATC -3'

Sequencing Primer
(F):5'- AAGAGGATTTCTGGGGGAAAATTTTC -3'
(R):5'- TTGGGCTAATGCTTTCATCTTAAG -3'
Posted On2016-11-09