Incidental Mutation 'H8562:Dync1h1'
ID44372
Institutional Source Beutler Lab
Gene Symbol Dync1h1
Ensembl Gene ENSMUSG00000018707
Gene Namedynein cytoplasmic 1 heavy chain 1
Synonyms9930018I23Rik, Dnchc1, dynein heavy chain, retrograde transport, Swl, MAP1C, Loa, Dnec1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #H8562 (G3) of strain 604
Quality Score219
Status Validated
Chromosome12
Chromosomal Location110601452-110666945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110616807 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 446 (M446T)
Ref Sequence ENSEMBL: ENSMUSP00000018851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018851]
PDB Structure
Microtubule binding domain from mouse cytoplasmic dynein as a fusion with seryl-tRNA synthetase [X-RAY DIFFRACTION]
High affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Low affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Structure of the entire stalk region of the dynein motor domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000018851
AA Change: M446T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000018851
Gene: ENSMUSG00000018707
AA Change: M446T

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
Pfam:DHC_N1 237 830 1.9e-145 PFAM
coiled coil region 1171 1198 N/A INTRINSIC
Pfam:DHC_N2 1317 1721 3.3e-116 PFAM
AAA 1899 2043 5.39e-2 SMART
low complexity region 2102 2116 N/A INTRINSIC
AAA 2214 2365 2.13e0 SMART
low complexity region 2394 2405 N/A INTRINSIC
AAA 2585 2735 8.6e-7 SMART
Blast:AAA 2777 2811 2e-13 BLAST
AAA 2927 3093 4.79e-5 SMART
Pfam:MT 3197 3534 1.1e-44 PFAM
Pfam:AAA_9 3554 3778 8.5e-75 PFAM
Pfam:Dynein_heavy 3919 4642 4.3e-163 PFAM
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (109/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are a group of microtubule-activated ATPases that function as molecular motors. They are divided into two subgroups of axonemal and cytoplasmic dyneins. The cytoplasmic dyneins function in intracellular motility, including retrograde axonal transport, protein sorting, organelle movement, and spindle dynamics. Molecules of conventional cytoplasmic dynein are comprised of 2 heavy chain polypeptides and a number of intermediate and light chains.This gene encodes a member of the cytoplasmic dynein heavy chain family. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for either the Cra1 or Loa ENU mutation exhibit neonatal lethality with reduced anterior horn cell number, abnormal motor neuron innervation, neuronal inclusions, and abnormal axonal transport. Heterozygotes display motor neuron degeneration and muscle spasms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,422,921 K251E probably benign Het
2810021J22Rik T C 11: 58,880,891 C400R probably damaging Het
4930519F16Rik A T X: 103,255,857 noncoding transcript Het
5430402E10Rik G T X: 77,922,734 H117Q probably damaging Het
Abca15 T C 7: 120,374,854 probably benign Het
Abca8a A G 11: 110,043,009 I1190T probably benign Het
Acmsd T C 1: 127,749,058 Y107H probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Aff2 G A X: 69,848,926 A939T unknown Het
Ampd2 C A 3: 108,081,111 A11S probably benign Het
Aoah T A 13: 20,816,524 C43S probably damaging Het
Apobec4 T C 1: 152,757,174 S318P probably damaging Het
Arid2 C T 15: 96,369,546 P636S possibly damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Bco1 G T 8: 117,105,647 probably benign Het
Brd3 C T 2: 27,450,533 G555S possibly damaging Het
Brd4 A T 17: 32,229,403 probably benign Het
Btbd7 A G 12: 102,788,302 V735A probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Carmil1 A G 13: 24,064,647 V485A probably benign Het
Casz1 T C 4: 148,933,451 L113P probably damaging Het
Ccdc3 T C 2: 5,138,205 L91S probably damaging Het
Cd180 A G 13: 102,705,418 K324R probably benign Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Cops7a A G 6: 124,962,453 probably benign Het
Cyp2c29 A T 19: 39,309,662 N217I probably damaging Het
Dapk1 C A 13: 60,761,312 H1246Q probably damaging Het
Dmbt1 T A 7: 131,112,076 C1450* probably null Het
Dnah10 T A 5: 124,829,529 M4151K probably damaging Het
Dnaic1 C A 4: 41,629,833 F452L possibly damaging Het
Dytn A C 1: 63,674,912 S143A possibly damaging Het
E130308A19Rik T A 4: 59,691,033 L289Q possibly damaging Het
Efemp2 G T 19: 5,480,649 V250L probably benign Het
Elmo1 T C 13: 20,280,863 S201P probably damaging Het
Fam208b A T 13: 3,577,000 S983R probably damaging Het
Fam222b T A 11: 78,154,578 C194S probably damaging Het
Fam91a1 G A 15: 58,427,121 probably null Het
Fcf1 T A 12: 84,980,612 probably benign Het
Fnip1 T A 11: 54,480,297 F134L probably damaging Het
Fyn T C 10: 39,511,954 S69P probably benign Het
Gabbr1 T C 17: 37,071,949 Y845H probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm13083 T A 4: 143,615,350 probably benign Het
Gm1966 A G 7: 106,603,149 F296S probably damaging Het
Gm5435 T C 12: 82,495,675 noncoding transcript Het
Gm7251 A G 13: 49,805,672 Y94H probably damaging Het
Heatr1 T A 13: 12,408,713 N530K probably benign Het
Hist1h2bn T C 13: 21,754,478 V119A probably benign Het
Icam5 A T 9: 21,035,146 E355V probably benign Het
Ighv3-6 A G 12: 114,288,538 probably benign Het
Intu T C 3: 40,692,673 S659P probably damaging Het
Ivns1abp T C 1: 151,354,695 V198A probably damaging Het
Katnb1 T A 8: 95,095,510 probably benign Het
Kcna5 T C 6: 126,533,423 S581G probably damaging Het
Kif23 A G 9: 61,924,065 V741A probably benign Het
Lbr A T 1: 181,820,668 probably benign Het
Loxhd1 A C 18: 77,341,931 T508P possibly damaging Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Ly96 A T 1: 16,691,694 K41N probably damaging Het
Lypd1 C T 1: 125,910,537 probably benign Het
Macf1 A G 4: 123,466,040 V1817A probably benign Het
Mknk2 A G 10: 80,668,934 probably benign Het
Mmp19 A T 10: 128,795,601 I117L probably benign Het
Mmrn1 G A 6: 60,958,180 G220D probably damaging Het
Mtrr T C 13: 68,564,377 H630R probably damaging Het
Nfat5 T C 8: 107,339,382 probably benign Het
Ngef C A 1: 87,487,807 K288N possibly damaging Het
Nkain4 T C 2: 180,943,145 E71G probably benign Het
Odc1 T C 12: 17,548,037 Y122H probably benign Het
Olfr384 T C 11: 73,603,447 I289T probably damaging Het
Olfr715 C A 7: 107,129,241 A51S probably benign Het
Olfr919 C A 9: 38,697,910 G156V probably damaging Het
Osbpl3 A T 6: 50,347,466 N190K probably benign Het
Osgepl1 T C 1: 53,315,039 V54A probably damaging Het
Otogl T C 10: 107,910,956 Y19C probably benign Het
Pop1 T C 15: 34,530,212 S919P probably benign Het
Prl8a9 A G 13: 27,562,601 probably benign Het
Prr14l A T 5: 32,793,728 V1907D probably damaging Het
Ptprn T C 1: 75,254,620 T547A possibly damaging Het
Rdh14 G T 12: 10,394,709 V187F probably damaging Het
Rev1 A G 1: 38,056,767 L853P probably damaging Het
Robo4 T C 9: 37,405,810 probably benign Het
Ryr2 A G 13: 11,717,141 probably benign Het
Sec16a G A 2: 26,441,505 P166L probably benign Het
Slc6a19 G A 13: 73,700,124 probably benign Het
Slco4c1 T A 1: 96,842,485 T285S probably benign Het
Speg G T 1: 75,415,597 A1633S probably benign Het
Srpk1 T A 17: 28,602,733 T236S probably benign Het
Stxbp5 T C 10: 9,769,443 N262S probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Syk A G 13: 52,640,621 N441D probably damaging Het
Syt17 T C 7: 118,408,069 K334R probably benign Het
Sytl5 A T X: 9,960,096 H436L probably benign Het
Thada A G 17: 84,446,544 L333P probably damaging Het
Thap12 T C 7: 98,715,107 Y161H probably damaging Het
Thbs2 C T 17: 14,671,453 V941I probably benign Het
Tktl1 A T X: 74,181,864 E72V probably damaging Het
Tm4sf5 T A 11: 70,505,512 probably benign Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vcp T A 4: 42,982,596 I699F probably damaging Het
Vmn1r232 T C 17: 20,913,394 T315A probably benign Het
Vmn2r100 T A 17: 19,521,490 W155R possibly damaging Het
Vmn2r19 T C 6: 123,315,902 I301T possibly damaging Het
Wwc2 A G 8: 47,920,666 V55A possibly damaging Het
Xirp2 A G 2: 67,515,457 T2681A probably benign Het
Zfp39 C A 11: 58,900,686 L58F probably damaging Het
Zfp612 T C 8: 110,090,038 F587L probably damaging Het
Zfp810 T C 9: 22,279,091 R174G probably benign Het
Other mutations in Dync1h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Dync1h1 APN 12 110649104 missense probably benign 0.31
IGL01299:Dync1h1 APN 12 110614107 missense probably benign 0.04
IGL01321:Dync1h1 APN 12 110625607 splice site probably benign
IGL01324:Dync1h1 APN 12 110626865 missense probably damaging 0.99
IGL01327:Dync1h1 APN 12 110616692 splice site probably benign
IGL01371:Dync1h1 APN 12 110638851 missense probably benign 0.05
IGL01598:Dync1h1 APN 12 110658128 missense probably damaging 0.99
IGL01782:Dync1h1 APN 12 110614940 missense probably damaging 1.00
IGL01791:Dync1h1 APN 12 110658930 missense probably damaging 0.99
IGL01797:Dync1h1 APN 12 110652196 critical splice donor site probably null
IGL02040:Dync1h1 APN 12 110637124 missense probably benign 0.21
IGL02096:Dync1h1 APN 12 110632820 missense possibly damaging 0.68
IGL02164:Dync1h1 APN 12 110662559 missense probably damaging 1.00
IGL02216:Dync1h1 APN 12 110663002 missense probably damaging 0.98
IGL02298:Dync1h1 APN 12 110640888 missense probably damaging 1.00
IGL02422:Dync1h1 APN 12 110640210 missense possibly damaging 0.68
IGL02610:Dync1h1 APN 12 110659232 nonsense probably null
IGL02643:Dync1h1 APN 12 110659272 unclassified probably benign
IGL03076:Dync1h1 APN 12 110657893 missense probably damaging 1.00
IGL03292:Dync1h1 APN 12 110666555 unclassified probably null
IGL03293:Dync1h1 APN 12 110628734 missense probably benign 0.12
IGL03299:Dync1h1 APN 12 110619210 missense possibly damaging 0.49
gymnast UTSW 12 110618368 missense probably damaging 1.00
lightfoot UTSW 12 110617920 missense probably damaging 1.00
Lissom UTSW 12 110632820 missense possibly damaging 0.68
ANU05:Dync1h1 UTSW 12 110649104 missense probably benign 0.31
R0082:Dync1h1 UTSW 12 110636446 missense probably benign
R0110:Dync1h1 UTSW 12 110639944 missense probably benign 0.42
R0130:Dync1h1 UTSW 12 110618674 missense probably benign 0.16
R0233:Dync1h1 UTSW 12 110640980 missense probably benign 0.45
R0233:Dync1h1 UTSW 12 110640980 missense probably benign 0.45
R0242:Dync1h1 UTSW 12 110649851 missense possibly damaging 0.67
R0242:Dync1h1 UTSW 12 110649851 missense possibly damaging 0.67
R0408:Dync1h1 UTSW 12 110631692 missense probably benign
R0450:Dync1h1 UTSW 12 110639944 missense probably benign 0.42
R0611:Dync1h1 UTSW 12 110632788 missense probably damaging 0.97
R0612:Dync1h1 UTSW 12 110616496 missense probably damaging 1.00
R0624:Dync1h1 UTSW 12 110651747 unclassified probably benign
R0685:Dync1h1 UTSW 12 110657192 missense probably damaging 1.00
R0747:Dync1h1 UTSW 12 110612411 missense probably benign
R0747:Dync1h1 UTSW 12 110629284 missense probably damaging 0.99
R0843:Dync1h1 UTSW 12 110665213 missense possibly damaging 0.81
R0970:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1161:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1211:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1214:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1215:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1227:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1230:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1232:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1237:Dync1h1 UTSW 12 110665959 missense probably benign 0.00
R1274:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1275:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1289:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1290:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1331:Dync1h1 UTSW 12 110649264 missense probably damaging 0.98
R1340:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1383:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1394:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1396:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1397:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1413:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1432:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1500:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1661:Dync1h1 UTSW 12 110656357 missense probably damaging 1.00
R1678:Dync1h1 UTSW 12 110665662 critical splice acceptor site probably null
R1698:Dync1h1 UTSW 12 110626992 missense possibly damaging 0.88
R1767:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1776:Dync1h1 UTSW 12 110632928 splice site probably benign
R1812:Dync1h1 UTSW 12 110662900 missense possibly damaging 0.46
R1831:Dync1h1 UTSW 12 110614059 missense probably damaging 1.00
R1832:Dync1h1 UTSW 12 110614059 missense probably damaging 1.00
R1856:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1857:Dync1h1 UTSW 12 110662625 missense probably damaging 0.96
R1879:Dync1h1 UTSW 12 110624636 missense probably benign 0.04
R1892:Dync1h1 UTSW 12 110646304 missense probably damaging 1.00
R1909:Dync1h1 UTSW 12 110662629 missense probably damaging 1.00
R1962:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1974:Dync1h1 UTSW 12 110625732 missense possibly damaging 0.80
R1999:Dync1h1 UTSW 12 110666423 critical splice donor site probably null
R2073:Dync1h1 UTSW 12 110614592 missense probably damaging 1.00
R2091:Dync1h1 UTSW 12 110649588 missense probably benign 0.07
R2113:Dync1h1 UTSW 12 110629986 missense probably damaging 1.00
R2128:Dync1h1 UTSW 12 110640882 missense probably damaging 1.00
R2134:Dync1h1 UTSW 12 110656631 missense possibly damaging 0.68
R2496:Dync1h1 UTSW 12 110641220 missense possibly damaging 0.65
R2680:Dync1h1 UTSW 12 110643247 missense probably damaging 1.00
R2890:Dync1h1 UTSW 12 110616891 missense probably damaging 1.00
R2964:Dync1h1 UTSW 12 110641026 critical splice donor site probably null
R3705:Dync1h1 UTSW 12 110640586 missense possibly damaging 0.80
R3708:Dync1h1 UTSW 12 110643129 missense probably damaging 0.96
R3735:Dync1h1 UTSW 12 110631675 missense probably benign
R3736:Dync1h1 UTSW 12 110631675 missense probably benign
R3882:Dync1h1 UTSW 12 110629058 missense probably benign 0.41
R3971:Dync1h1 UTSW 12 110665965 missense probably benign 0.00
R4017:Dync1h1 UTSW 12 110643190 missense probably damaging 1.00
R4032:Dync1h1 UTSW 12 110618049 nonsense probably null
R4355:Dync1h1 UTSW 12 110632899 missense possibly damaging 0.55
R4514:Dync1h1 UTSW 12 110657139 missense possibly damaging 0.76
R4586:Dync1h1 UTSW 12 110649483 missense probably benign 0.30
R4619:Dync1h1 UTSW 12 110638844 missense probably benign 0.09
R4659:Dync1h1 UTSW 12 110628767 missense possibly damaging 0.50
R4676:Dync1h1 UTSW 12 110662541 missense probably damaging 0.99
R4688:Dync1h1 UTSW 12 110655528 missense probably damaging 0.99
R4732:Dync1h1 UTSW 12 110649507 nonsense probably null
R4733:Dync1h1 UTSW 12 110649507 nonsense probably null
R4780:Dync1h1 UTSW 12 110661196 missense probably damaging 1.00
R4846:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4865:Dync1h1 UTSW 12 110639801 missense possibly damaging 0.84
R4872:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4873:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4874:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4875:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4927:Dync1h1 UTSW 12 110662855 missense possibly damaging 0.82
R4949:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4954:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4956:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4957:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4958:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4984:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4985:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4988:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R5029:Dync1h1 UTSW 12 110618010 missense possibly damaging 0.46
R5032:Dync1h1 UTSW 12 110626892 nonsense probably null
R5036:Dync1h1 UTSW 12 110630535 missense probably damaging 1.00
R5037:Dync1h1 UTSW 12 110640907 missense probably benign 0.09
R5105:Dync1h1 UTSW 12 110617932 missense probably damaging 0.99
R5122:Dync1h1 UTSW 12 110629680 missense probably damaging 1.00
R5156:Dync1h1 UTSW 12 110628830 missense probably benign 0.00
R5290:Dync1h1 UTSW 12 110615068 missense probably benign 0.03
R5453:Dync1h1 UTSW 12 110632665 missense probably benign 0.12
R5540:Dync1h1 UTSW 12 110660950 missense probably benign 0.00
R5613:Dync1h1 UTSW 12 110632820 missense possibly damaging 0.68
R5626:Dync1h1 UTSW 12 110641141 missense probably benign 0.01
R5652:Dync1h1 UTSW 12 110665988 missense possibly damaging 0.70
R5655:Dync1h1 UTSW 12 110629062 missense probably benign 0.03
R5686:Dync1h1 UTSW 12 110616404 missense probably benign 0.35
R5772:Dync1h1 UTSW 12 110646273 nonsense probably null
R5806:Dync1h1 UTSW 12 110651653 missense probably damaging 1.00
R5891:Dync1h1 UTSW 12 110614220 critical splice donor site probably null
R5921:Dync1h1 UTSW 12 110618368 missense probably damaging 1.00
R5965:Dync1h1 UTSW 12 110632778 missense probably benign
R6113:Dync1h1 UTSW 12 110620414 missense probably benign
R6119:Dync1h1 UTSW 12 110628006 missense possibly damaging 0.82
R6154:Dync1h1 UTSW 12 110617993 missense probably damaging 1.00
R6339:Dync1h1 UTSW 12 110646205 missense probably damaging 0.97
R6522:Dync1h1 UTSW 12 110616737 missense probably damaging 0.99
R6531:Dync1h1 UTSW 12 110617920 missense probably damaging 1.00
R6554:Dync1h1 UTSW 12 110649848 missense probably benign 0.06
R6672:Dync1h1 UTSW 12 110658134 missense probably damaging 1.00
R6746:Dync1h1 UTSW 12 110651653 missense probably damaging 1.00
R6785:Dync1h1 UTSW 12 110629679 missense probably damaging 1.00
R6857:Dync1h1 UTSW 12 110658547 missense possibly damaging 0.94
R6863:Dync1h1 UTSW 12 110652180 missense probably benign 0.07
R6881:Dync1h1 UTSW 12 110624561 missense probably damaging 1.00
R6892:Dync1h1 UTSW 12 110638901 missense probably benign 0.00
R7015:Dync1h1 UTSW 12 110666087 nonsense probably null
R7096:Dync1h1 UTSW 12 110657078 missense not run
Z1088:Dync1h1 UTSW 12 110629917 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACACGAAGTACCCGATTCAGCG -3'
(R):5'- AAACATGGAGTACCAGGCCGTCAG -3'

Sequencing Primer
(F):5'- CAGAGACCTGAGTTCTCAGC -3'
(R):5'- ACCAGGCCGTCAGTTCTTTC -3'
Posted On2013-06-11