Incidental Mutation 'R5692:Dennd4b'
ID443720
Institutional Source Beutler Lab
Gene Symbol Dennd4b
Ensembl Gene ENSMUSG00000042404
Gene NameDENN/MADD domain containing 4B
Synonyms
MMRRC Submission 043179-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R5692 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location90265185-90280669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90277783 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1166 (Y1166H)
Ref Sequence ENSEMBL: ENSMUSP00000117354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098914] [ENSMUST00000129564]
Predicted Effect probably damaging
Transcript: ENSMUST00000098914
AA Change: Y1177H

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096514
Gene: ENSMUSG00000042404
AA Change: Y1177H

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
uDENN 183 290 1.15e-29 SMART
DENN 324 508 5.26e-70 SMART
dDENN 573 647 1.75e-25 SMART
low complexity region 672 690 N/A INTRINSIC
low complexity region 740 752 N/A INTRINSIC
coiled coil region 902 928 N/A INTRINSIC
low complexity region 1022 1038 N/A INTRINSIC
low complexity region 1086 1096 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1131 1148 N/A INTRINSIC
low complexity region 1338 1350 N/A INTRINSIC
low complexity region 1424 1439 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129564
AA Change: Y1166H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117354
Gene: ENSMUSG00000042404
AA Change: Y1166H

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
uDENN 172 279 1.15e-29 SMART
DENN 313 497 5.26e-70 SMART
dDENN 562 636 1.75e-25 SMART
low complexity region 661 679 N/A INTRINSIC
low complexity region 729 741 N/A INTRINSIC
coiled coil region 891 917 N/A INTRINSIC
low complexity region 1011 1027 N/A INTRINSIC
low complexity region 1075 1085 N/A INTRINSIC
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1120 1137 N/A INTRINSIC
low complexity region 1327 1339 N/A INTRINSIC
low complexity region 1413 1428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138376
SMART Domains Protein: ENSMUSP00000116003
Gene: ENSMUSG00000042404

DomainStartEndE-ValueType
coiled coil region 29 55 N/A INTRINSIC
low complexity region 148 164 N/A INTRINSIC
low complexity region 212 222 N/A INTRINSIC
low complexity region 240 253 N/A INTRINSIC
low complexity region 257 264 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143803
Predicted Effect probably benign
Transcript: ENSMUST00000156358
SMART Domains Protein: ENSMUSP00000118483
Gene: ENSMUSG00000042404

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
Blast:uDENN 39 97 9e-6 BLAST
Blast:uDENN 164 207 1e-22 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik G A 9: 8,221,990 noncoding transcript Het
Adcy10 A G 1: 165,515,306 N247S probably benign Het
Ago3 T C 4: 126,355,069 probably null Het
Aldh16a1 A G 7: 45,147,799 V168A probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap26 T A 18: 39,121,892 V274E probably damaging Het
Clec4d T C 6: 123,268,145 probably null Het
Egln3 T C 12: 54,180,661 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fhad1 T A 4: 141,963,457 M434L probably benign Het
Gfm1 T G 3: 67,435,622 M163R probably damaging Het
Isg15 A T 4: 156,199,822 L83Q probably damaging Het
Ly9 GCCTTTGGGGGACAATTCC GCC 1: 171,605,187 probably null Het
Med1 G T 11: 98,156,380 probably benign Het
Mrc2 T A 11: 105,336,642 V567D probably damaging Het
Nnmt G T 9: 48,603,480 T79K probably benign Het
Opn1sw G A 6: 29,379,841 probably benign Het
Optc G T 1: 133,900,976 probably benign Het
Pcdh17 C T 14: 84,448,540 P816S probably benign Het
Pcdhb15 T C 18: 37,474,449 S245P probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Sacs T C 14: 61,207,839 F2445L probably benign Het
Sel1l T C 12: 91,811,878 N721S probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc7a11 C G 3: 50,372,331 V494L probably benign Het
Sulf2 C A 2: 166,081,506 A598S probably benign Het
Tph2 A T 10: 115,184,827 D21E probably damaging Het
Trf T C 9: 103,226,125 Y110C possibly damaging Het
Ttn C T 2: 76,797,858 E14653K possibly damaging Het
Vmn2r18 A G 5: 151,562,259 I590T possibly damaging Het
Zfp607b G T 7: 27,703,464 K448N probably benign Het
Zfp689 T C 7: 127,448,899 probably benign Het
Zfp709 C T 8: 71,890,155 P476L probably damaging Het
Other mutations in Dennd4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Dennd4b APN 3 90271207 missense possibly damaging 0.83
IGL00834:Dennd4b APN 3 90279686 critical splice donor site probably null
IGL01124:Dennd4b APN 3 90269074 missense possibly damaging 0.61
IGL01792:Dennd4b APN 3 90279845 missense probably damaging 0.96
IGL01895:Dennd4b APN 3 90275567 missense probably benign 0.00
IGL02533:Dennd4b APN 3 90272310 missense probably benign 0.02
IGL02630:Dennd4b APN 3 90272977 missense probably benign 0.00
R0107:Dennd4b UTSW 3 90272736 missense possibly damaging 0.92
R0143:Dennd4b UTSW 3 90272364 missense probably damaging 1.00
R1079:Dennd4b UTSW 3 90271178 missense probably benign
R1306:Dennd4b UTSW 3 90271165 missense probably benign 0.00
R1525:Dennd4b UTSW 3 90270870 missense probably damaging 0.97
R1756:Dennd4b UTSW 3 90271605 missense probably damaging 1.00
R1959:Dennd4b UTSW 3 90268773 missense probably damaging 1.00
R1976:Dennd4b UTSW 3 90273055 missense probably damaging 1.00
R2184:Dennd4b UTSW 3 90275540 missense probably damaging 1.00
R2296:Dennd4b UTSW 3 90275514 missense probably damaging 1.00
R2406:Dennd4b UTSW 3 90275488 missense probably damaging 1.00
R2408:Dennd4b UTSW 3 90271575 nonsense probably null
R4691:Dennd4b UTSW 3 90272312 missense probably damaging 1.00
R5376:Dennd4b UTSW 3 90278056 missense probably benign 0.00
R5466:Dennd4b UTSW 3 90268500 splice site probably null
R5555:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5556:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5557:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5605:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5617:Dennd4b UTSW 3 90275626 missense probably benign
R5790:Dennd4b UTSW 3 90277450 missense probably damaging 1.00
R5957:Dennd4b UTSW 3 90270965 missense probably damaging 1.00
R6130:Dennd4b UTSW 3 90276259 missense probably damaging 1.00
R6183:Dennd4b UTSW 3 90275568 utr 3 prime probably benign
R6505:Dennd4b UTSW 3 90267611 missense probably damaging 1.00
R6631:Dennd4b UTSW 3 90277732 splice site probably null
R6801:Dennd4b UTSW 3 90268779 missense probably damaging 0.98
X0024:Dennd4b UTSW 3 90270971 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TATCTCCCTGGAAAGGCAGGAG -3'
(R):5'- CTAGGTGCACTGTAGGGAAC -3'

Sequencing Primer
(F):5'- CCTGGAAAGGCAGGAGACAGG -3'
(R):5'- GCGTCAGCTCTCTCGGAG -3'
Posted On2016-11-09