Incidental Mutation 'R5692:1700128F08Rik'
List |< first << previous [record 94 of 32981] next >> last >|
ID443736
Institutional Source Beutler Lab
Gene Symbol 1700128F08Rik
Ensembl Gene ENSMUSG00000031998
Gene NameRIKEN cDNA 1700128F08 gene
Synonyms
MMRRC Submission 043179-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R5692 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location8221889-8241987 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) G to A at 8221990 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model
Predicted Effect noncoding transcript
Transcript: ENSMUST00000034483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213708
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A G 1: 165,515,306 N247S probably benign Het
Ago3 T C 4: 126,355,069 probably null Het
Aldh16a1 A G 7: 45,147,799 V168A probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap26 T A 18: 39,121,892 V274E probably damaging Het
Clec4d T C 6: 123,268,145 probably null Het
Dennd4b T C 3: 90,277,783 Y1166H probably damaging Het
Egln3 T C 12: 54,180,661 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fhad1 T A 4: 141,963,457 M434L probably benign Het
Gfm1 T G 3: 67,435,622 M163R probably damaging Het
Isg15 A T 4: 156,199,822 L83Q probably damaging Het
Ly9 GCCTTTGGGGGACAATTCC GCC 1: 171,605,187 probably null Het
Med1 G T 11: 98,156,380 probably benign Het
Mrc2 T A 11: 105,336,642 V567D probably damaging Het
Nnmt G T 9: 48,603,480 T79K probably benign Het
Opn1sw G A 6: 29,379,841 probably benign Het
Optc G T 1: 133,900,976 probably benign Het
Pcdh17 C T 14: 84,448,540 P816S probably benign Het
Pcdhb15 T C 18: 37,474,449 S245P probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Sacs T C 14: 61,207,839 F2445L probably benign Het
Sel1l T C 12: 91,811,878 N721S probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc7a11 C G 3: 50,372,331 V494L probably benign Het
Sulf2 C A 2: 166,081,506 A598S probably benign Het
Tph2 A T 10: 115,184,827 D21E probably damaging Het
Trf T C 9: 103,226,125 Y110C possibly damaging Het
Ttn C T 2: 76,797,858 E14653K possibly damaging Het
Vmn2r18 A G 5: 151,562,259 I590T possibly damaging Het
Zfp607b G T 7: 27,703,464 K448N probably benign Het
Zfp689 T C 7: 127,448,899 probably benign Het
Zfp709 C T 8: 71,890,155 P476L probably damaging Het
Other mutations in 1700128F08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0472:1700128F08Rik UTSW 9 8222122 exon noncoding transcript
R1114:1700128F08Rik UTSW 9 8222178 exon noncoding transcript
R4732:1700128F08Rik UTSW 9 8222173 exon noncoding transcript
R4733:1700128F08Rik UTSW 9 8222173 exon noncoding transcript
R4970:1700128F08Rik UTSW 9 8222065 exon noncoding transcript
R5699:1700128F08Rik UTSW 9 8225319 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGTTCAGGCATAGCTGGAACC -3'
(R):5'- TGTCACCATACCGGGAGAAC -3'

Sequencing Primer
(F):5'- CATAGCTGGAACCTGGGTAC -3'
(R):5'- CATACCGGGAGAACTTCTCTTTGG -3'
Posted On2016-11-09