Mutagenetix > Incidental Mutation

Incidental Mutation 'R5693:Ptprf'

443762

Institutional Source

Beutler Lab

Gene Symbol

Ptprf

Ensembl Gene

ENSMUSG00000033295

Gene Name

protein tyrosine phosphatase receptor type F

Synonyms

RPTP-LAR, LAR

MMRRC Submission

043180-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.657) question?

Stock #

R5693 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118065410-118148602 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 118093374 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 90 (R90*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049074] [ENSMUST00000222620]

AlphaFold

A2A8L5

Predicted Effect

probably null
Transcript: ENSMUST00000049074
AA Change: R423*

SMART Domains

Protein: ENSMUSP00000039368
Gene: ENSMUSG00000033295
AA Change: R423*

Domain	Start	End	E-Value	Type
IGc2	45	114	2.64e-12	SMART
IGc2	147	214	1.48e-15	SMART
IG	238	316	1.06e-11	SMART
FN3	319	398	6.9e-14	SMART
FN3	414	497	5.73e-11	SMART
FN3	512	591	4.06e-11	SMART
FN3	606	693	8.69e-11	SMART
FN3	709	797	8.83e-12	SMART
FN3	812	892	3.2e-9	SMART
FN3	907	988	2.53e-12	SMART
FN3	1003	1079	3.48e-1	SMART
coiled coil region	1146	1175	N/A	INTRINSIC
transmembrane domain	1253	1275	N/A	INTRINSIC
PTPc	1342	1600	1.12e-138	SMART
PTPc	1629	1891	3.4e-129	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124758

SMART Domains

Protein: ENSMUSP00000119954
Gene: ENSMUSG00000033295

Domain	Start	End	E-Value	Type
FN3	37	116	4.06e-11	SMART
FN3	132	220	8.83e-12	SMART
FN3	235	315	3.2e-9	SMART
FN3	330	411	2.53e-12	SMART
FN3	426	502	3.48e-1	SMART
coiled coil region	568	597	N/A	INTRINSIC
transmembrane domain	676	698	N/A	INTRINSIC
PTPc	776	1034	1.12e-138	SMART
PTPc	1063	1325	3.4e-129	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000150096
AA Change: R90*

SMART Domains

Protein: ENSMUSP00000117313
Gene: ENSMUSG00000033295
AA Change: R90*

Domain	Start	End	E-Value	Type
FN3	14	66	2.7e1	SMART
FN3	82	165	5.73e-11	SMART
FN3	180	259	4.06e-11	SMART
FN3	275	372	6.69e-12	SMART
FN3	385	461	2.83e-1	SMART
coiled coil region	527	556	N/A	INTRINSIC
transmembrane domain	635	657	N/A	INTRINSIC
PTPc	735	993	1.12e-138	SMART
PTPc	1022	1284	3.4e-129	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000222620

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females have premature involution of the mammary glands leading to an inability to feed pups. Other characteristics of null mice include defective nerve regeneration and hyperactivity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,266,233 (GRCm39)	I3071V	probably benign	Het
Abcb8	C	T	5: 24,605,137 (GRCm39)	R108C	possibly damaging	Het
Abr	T	C	11: 76,354,403 (GRCm39)	N236S	probably damaging	Het
Adcy6	T	C	15: 98,501,870 (GRCm39)	Y248C	probably damaging	Het
Armc8	A	G	9: 99,378,202 (GRCm39)		probably null	Het
Chd6	A	T	2: 160,807,185 (GRCm39)	S2010T	probably benign	Het
Dcc	G	A	18: 71,708,153 (GRCm39)	T521I	probably damaging	Het
Dmrtb1	G	A	4: 107,541,366 (GRCm39)		probably benign	Het
Evc	A	G	5: 37,477,584 (GRCm39)	V365A	possibly damaging	Het
Gata4	A	G	14: 63,478,594 (GRCm39)	Y2H	probably damaging	Het
Gpc1	A	G	1: 92,785,621 (GRCm39)	N437S	probably damaging	Het
Lifr	T	C	15: 7,205,041 (GRCm39)	V426A	probably damaging	Het
Lpin3	A	G	2: 160,737,320 (GRCm39)	I122M	probably benign	Het
Muc4	A	G	16: 32,597,181 (GRCm39)	N3174D	possibly damaging	Het
Myo6	G	A	9: 80,173,462 (GRCm39)	R534H	probably damaging	Het
Nectin2	T	C	7: 19,458,794 (GRCm39)	D339G	probably benign	Het
Oprd1	G	A	4: 131,871,721 (GRCm39)		probably benign	Het
Or6c66	T	C	10: 129,461,396 (GRCm39)	D178G	probably damaging	Het
Orc1	G	A	4: 108,470,276 (GRCm39)	V751I	probably benign	Het
Pacs2	T	C	12: 113,013,526 (GRCm39)	S175P	probably damaging	Het
Pik3r5	C	T	11: 68,385,077 (GRCm39)	R661C	probably damaging	Het
Plscr5	A	T	9: 92,087,564 (GRCm39)	K178*	probably null	Het
Prkar1b	A	G	5: 139,113,400 (GRCm39)	V40A	possibly damaging	Het
Rasef	T	C	4: 73,688,076 (GRCm39)	M26V	probably damaging	Het
Rfx1	C	A	8: 84,800,533 (GRCm39)	Q45K	unknown	Het
Rnf183	A	G	4: 62,346,753 (GRCm39)	V15A	possibly damaging	Het
Slc10a2	C	A	8: 5,155,128 (GRCm39)	C19F	probably damaging	Het
Slc14a2	T	A	18: 78,190,229 (GRCm39)	I907F	probably benign	Het
Snx16	T	C	3: 10,485,318 (GRCm39)	I293V	probably benign	Het
Srcap	C	A	7: 127,118,988 (GRCm39)	A97E	probably damaging	Het
Thyn1	G	T	9: 26,916,511 (GRCm39)		probably null	Het
Tiparp	T	C	3: 65,460,913 (GRCm39)	I634T	possibly damaging	Het
Tjp1	G	A	7: 64,992,411 (GRCm39)	A156V	possibly damaging	Het
Tmem168	T	C	6: 13,602,320 (GRCm39)	M349V	probably benign	Het
Tyro3	T	G	2: 119,641,349 (GRCm39)	F519L	probably damaging	Het
Vmn1r167	A	T	7: 23,204,646 (GRCm39)	Y123*	probably null	Het
Vmn1r183	C	T	7: 23,754,227 (GRCm39)	T10I	possibly damaging	Het
Zfp654	T	C	16: 64,606,289 (GRCm39)	T97A	probably benign	Het

Other mutations in Ptprf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Ptprf	APN	4	118,080,417 (GRCm39)	splice site	probably benign
IGL01337:Ptprf	APN	4	118,093,488 (GRCm39)	missense	probably damaging	1.00
IGL01482:Ptprf	APN	4	118,069,651 (GRCm39)	missense	probably damaging	1.00
IGL01743:Ptprf	APN	4	118,106,095 (GRCm39)	critical splice donor site	probably null
IGL01987:Ptprf	APN	4	118,134,567 (GRCm39)	missense	probably benign
IGL02189:Ptprf	APN	4	118,070,839 (GRCm39)	splice site	probably benign
IGL03067:Ptprf	APN	4	118,067,910 (GRCm39)	missense	possibly damaging	0.67
PIT4677001:Ptprf	UTSW	4	118,070,809 (GRCm39)	missense	probably damaging	1.00
R0382:Ptprf	UTSW	4	118,080,591 (GRCm39)	splice site	probably benign
R0788:Ptprf	UTSW	4	118,083,663 (GRCm39)	missense	probably damaging	0.97
R1164:Ptprf	UTSW	4	118,114,689 (GRCm39)	missense	probably damaging	1.00
R1478:Ptprf	UTSW	4	118,069,302 (GRCm39)	nonsense	probably null
R1483:Ptprf	UTSW	4	118,093,161 (GRCm39)	missense	possibly damaging	0.81
R1611:Ptprf	UTSW	4	118,093,430 (GRCm39)	missense	probably benign	0.34
R1721:Ptprf	UTSW	4	118,082,096 (GRCm39)	missense	possibly damaging	0.56
R1817:Ptprf	UTSW	4	118,080,462 (GRCm39)	missense	probably benign	0.02
R1818:Ptprf	UTSW	4	118,067,068 (GRCm39)	missense	probably damaging	1.00
R1860:Ptprf	UTSW	4	118,081,129 (GRCm39)	missense	probably damaging	1.00
R2208:Ptprf	UTSW	4	118,126,369 (GRCm39)	splice site	probably benign
R2406:Ptprf	UTSW	4	118,126,501 (GRCm39)	missense	possibly damaging	0.62
R2912:Ptprf	UTSW	4	118,106,177 (GRCm39)	missense	probably damaging	0.98
R3111:Ptprf	UTSW	4	118,068,629 (GRCm39)	missense	probably damaging	1.00
R3498:Ptprf	UTSW	4	118,082,127 (GRCm39)	missense	probably damaging	0.99
R3499:Ptprf	UTSW	4	118,082,127 (GRCm39)	missense	probably damaging	0.99
R3615:Ptprf	UTSW	4	118,095,080 (GRCm39)	missense	probably benign	0.04
R3616:Ptprf	UTSW	4	118,095,080 (GRCm39)	missense	probably benign	0.04
R4038:Ptprf	UTSW	4	118,114,805 (GRCm39)	missense	probably damaging	1.00
R4243:Ptprf	UTSW	4	118,083,649 (GRCm39)	critical splice donor site	probably null
R4260:Ptprf	UTSW	4	118,083,280 (GRCm39)	missense	possibly damaging	0.64
R4693:Ptprf	UTSW	4	118,068,219 (GRCm39)	missense	probably benign	0.16
R4726:Ptprf	UTSW	4	118,069,414 (GRCm39)	missense	possibly damaging	0.86
R4746:Ptprf	UTSW	4	118,082,236 (GRCm39)	missense	possibly damaging	0.83
R4802:Ptprf	UTSW	4	118,067,526 (GRCm39)	intron	probably benign
R4857:Ptprf	UTSW	4	118,074,394 (GRCm39)	splice site	probably benign
R5071:Ptprf	UTSW	4	118,069,196 (GRCm39)	missense	probably damaging	1.00
R5221:Ptprf	UTSW	4	118,082,305 (GRCm39)	missense	probably benign	0.00
R5327:Ptprf	UTSW	4	118,093,586 (GRCm39)	missense	probably damaging	1.00
R5336:Ptprf	UTSW	4	118,092,831 (GRCm39)	missense	probably damaging	1.00
R5356:Ptprf	UTSW	4	118,083,535 (GRCm39)	missense	probably benign	0.00
R5373:Ptprf	UTSW	4	118,083,238 (GRCm39)	missense	possibly damaging	0.93
R5555:Ptprf	UTSW	4	118,082,121 (GRCm39)	missense	probably damaging	1.00
R5860:Ptprf	UTSW	4	118,068,486 (GRCm39)	intron	probably benign
R5869:Ptprf	UTSW	4	118,067,579 (GRCm39)	missense	probably damaging	1.00
R5890:Ptprf	UTSW	4	118,081,932 (GRCm39)	missense	probably benign
R5932:Ptprf	UTSW	4	118,068,964 (GRCm39)	missense	probably benign	0.10
R6028:Ptprf	UTSW	4	118,070,826 (GRCm39)	missense	probably benign	0.01
R6030:Ptprf	UTSW	4	118,068,245 (GRCm39)	missense	probably benign	0.19
R6030:Ptprf	UTSW	4	118,068,245 (GRCm39)	missense	probably benign	0.19
R6088:Ptprf	UTSW	4	118,067,952 (GRCm39)	missense	possibly damaging	0.68
R6089:Ptprf	UTSW	4	118,068,281 (GRCm39)	missense	probably damaging	0.99
R6108:Ptprf	UTSW	4	118,080,453 (GRCm39)	missense	probably benign	0.01
R6320:Ptprf	UTSW	4	118,070,011 (GRCm39)	missense	probably benign
R6741:Ptprf	UTSW	4	118,080,565 (GRCm39)	missense	probably benign	0.00
R6744:Ptprf	UTSW	4	118,093,562 (GRCm39)	missense	probably benign	0.00
R6750:Ptprf	UTSW	4	118,088,928 (GRCm39)	missense	probably benign	0.03
R6906:Ptprf	UTSW	4	118,126,474 (GRCm39)	missense	possibly damaging	0.95
R7021:Ptprf	UTSW	4	118,081,101 (GRCm39)	missense	probably benign	0.00
R7153:Ptprf	UTSW	4	118,088,740 (GRCm39)	missense	probably damaging	1.00
R7326:Ptprf	UTSW	4	118,088,866 (GRCm39)	missense	probably damaging	0.99
R7337:Ptprf	UTSW	4	118,068,322 (GRCm39)	missense	probably damaging	0.99
R7374:Ptprf	UTSW	4	118,114,689 (GRCm39)	missense	probably damaging	1.00
R7375:Ptprf	UTSW	4	118,070,011 (GRCm39)	missense	probably benign
R7399:Ptprf	UTSW	4	118,083,720 (GRCm39)	missense	probably benign	0.28
R7417:Ptprf	UTSW	4	118,069,369 (GRCm39)	missense	probably damaging	1.00
R7448:Ptprf	UTSW	4	118,092,864 (GRCm39)	missense	probably benign	0.03
R7530:Ptprf	UTSW	4	118,069,945 (GRCm39)	missense	probably damaging	1.00
R7593:Ptprf	UTSW	4	118,069,593 (GRCm39)	missense	probably benign	0.00
R8172:Ptprf	UTSW	4	118,068,275 (GRCm39)	missense	probably benign	0.03
R8239:Ptprf	UTSW	4	118,069,309 (GRCm39)	missense	possibly damaging	0.88
R8257:Ptprf	UTSW	4	118,083,476 (GRCm39)	missense	probably damaging	0.96
R8331:Ptprf	UTSW	4	118,083,263 (GRCm39)	missense	probably benign	0.27
R8441:Ptprf	UTSW	4	118,075,255 (GRCm39)	splice site	probably benign
R8681:Ptprf	UTSW	4	118,088,844 (GRCm39)	missense	probably benign	0.02
R8771:Ptprf	UTSW	4	118,068,987 (GRCm39)	missense	possibly damaging	0.95
R8815:Ptprf	UTSW	4	118,095,125 (GRCm39)	missense	possibly damaging	0.52
R8998:Ptprf	UTSW	4	118,083,671 (GRCm39)	missense	probably benign	0.00
R8999:Ptprf	UTSW	4	118,083,671 (GRCm39)	missense	probably benign	0.00
R9389:Ptprf	UTSW	4	118,093,236 (GRCm39)	missense	probably benign
R9508:Ptprf	UTSW	4	118,126,776 (GRCm39)	nonsense	probably null
R9581:Ptprf	UTSW	4	118,092,257 (GRCm39)	missense	probably benign	0.00
X0067:Ptprf	UTSW	4	118,093,223 (GRCm39)	missense	possibly damaging	0.85
Z1177:Ptprf	UTSW	4	118,126,812 (GRCm39)	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CTGTAGGTGATGCCAGGTAG -3'
(R):5'- CTTCTACGGCATCCAGTACC -3'

Sequencing Primer
(F):5'- TGCCAGGTAGCAGGCTG -3'
(R):5'- CATCCAGTACCGCGCAG -3'

Posted On

2016-11-09