Incidental Mutation 'R5693:Pik3r5'
ID 443782
Institutional Source Beutler Lab
Gene Symbol Pik3r5
Ensembl Gene ENSMUSG00000020901
Gene Name phosphoinositide-3-kinase regulatory subunit 5
Synonyms p101, Foap2
MMRRC Submission 043180-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.098) question?
Stock # R5693 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 68322951-68388675 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 68385077 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 661 (R661C)
Ref Sequence ENSEMBL: ENSMUSP00000021283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021283]
AlphaFold Q5SW28
Predicted Effect probably damaging
Transcript: ENSMUST00000021283
AA Change: R661C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021283
Gene: ENSMUSG00000020901
AA Change: R661C

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 6 871 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155887
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinases (PI3Ks) phosphorylate the inositol ring of phosphatidylinositol at the 3-prime position, and play important roles in cell growth, proliferation, differentiation, motility, survival and intracellular trafficking. The PI3Ks are divided into three classes: I, II and III, and only the class I PI3Ks are involved in oncogenesis. This gene encodes the 101 kD regulatory subunit of the class I PI3K gamma complex, which is a dimeric enzyme, consisting of a 110 kD catalytic subunit gamma and a regulatory subunit of either 55, 87 or 101 kD. This protein recruits the catalytic subunit from the cytosol to the plasma membrane through high-affinity interaction with G-beta-gamma proteins. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been found. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced neutrophil chemotaxis and chemokinesis in vitro and impaired neutrophil recruitment into the peritoneum in a model of thioglycollate-induced aseptic peritonitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,266,233 (GRCm39) I3071V probably benign Het
Abcb8 C T 5: 24,605,137 (GRCm39) R108C possibly damaging Het
Abr T C 11: 76,354,403 (GRCm39) N236S probably damaging Het
Adcy6 T C 15: 98,501,870 (GRCm39) Y248C probably damaging Het
Armc8 A G 9: 99,378,202 (GRCm39) probably null Het
Chd6 A T 2: 160,807,185 (GRCm39) S2010T probably benign Het
Dcc G A 18: 71,708,153 (GRCm39) T521I probably damaging Het
Dmrtb1 G A 4: 107,541,366 (GRCm39) probably benign Het
Evc A G 5: 37,477,584 (GRCm39) V365A possibly damaging Het
Gata4 A G 14: 63,478,594 (GRCm39) Y2H probably damaging Het
Gpc1 A G 1: 92,785,621 (GRCm39) N437S probably damaging Het
Lifr T C 15: 7,205,041 (GRCm39) V426A probably damaging Het
Lpin3 A G 2: 160,737,320 (GRCm39) I122M probably benign Het
Muc4 A G 16: 32,597,181 (GRCm39) N3174D possibly damaging Het
Myo6 G A 9: 80,173,462 (GRCm39) R534H probably damaging Het
Nectin2 T C 7: 19,458,794 (GRCm39) D339G probably benign Het
Oprd1 G A 4: 131,871,721 (GRCm39) probably benign Het
Or6c66 T C 10: 129,461,396 (GRCm39) D178G probably damaging Het
Orc1 G A 4: 108,470,276 (GRCm39) V751I probably benign Het
Pacs2 T C 12: 113,013,526 (GRCm39) S175P probably damaging Het
Plscr5 A T 9: 92,087,564 (GRCm39) K178* probably null Het
Prkar1b A G 5: 139,113,400 (GRCm39) V40A possibly damaging Het
Ptprf G A 4: 118,093,374 (GRCm39) R90* probably null Het
Rasef T C 4: 73,688,076 (GRCm39) M26V probably damaging Het
Rfx1 C A 8: 84,800,533 (GRCm39) Q45K unknown Het
Rnf183 A G 4: 62,346,753 (GRCm39) V15A possibly damaging Het
Slc10a2 C A 8: 5,155,128 (GRCm39) C19F probably damaging Het
Slc14a2 T A 18: 78,190,229 (GRCm39) I907F probably benign Het
Snx16 T C 3: 10,485,318 (GRCm39) I293V probably benign Het
Srcap C A 7: 127,118,988 (GRCm39) A97E probably damaging Het
Thyn1 G T 9: 26,916,511 (GRCm39) probably null Het
Tiparp T C 3: 65,460,913 (GRCm39) I634T possibly damaging Het
Tjp1 G A 7: 64,992,411 (GRCm39) A156V possibly damaging Het
Tmem168 T C 6: 13,602,320 (GRCm39) M349V probably benign Het
Tyro3 T G 2: 119,641,349 (GRCm39) F519L probably damaging Het
Vmn1r167 A T 7: 23,204,646 (GRCm39) Y123* probably null Het
Vmn1r183 C T 7: 23,754,227 (GRCm39) T10I possibly damaging Het
Zfp654 T C 16: 64,606,289 (GRCm39) T97A probably benign Het
Other mutations in Pik3r5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Pik3r5 APN 11 68,387,020 (GRCm39) missense possibly damaging 0.68
IGL01400:Pik3r5 APN 11 68,385,373 (GRCm39) missense probably benign 0.01
IGL01597:Pik3r5 APN 11 68,386,827 (GRCm39) missense probably damaging 1.00
IGL01622:Pik3r5 APN 11 68,377,452 (GRCm39) splice site probably null
IGL01623:Pik3r5 APN 11 68,377,452 (GRCm39) splice site probably null
IGL01878:Pik3r5 APN 11 68,383,356 (GRCm39) missense probably benign 0.00
IGL01953:Pik3r5 APN 11 68,384,997 (GRCm39) missense probably benign 0.00
IGL02056:Pik3r5 APN 11 68,381,681 (GRCm39) missense possibly damaging 0.86
IGL02345:Pik3r5 APN 11 68,383,552 (GRCm39) missense probably benign 0.03
palmetto UTSW 11 68,385,059 (GRCm39) missense probably damaging 1.00
Palmito UTSW 11 68,382,826 (GRCm39) missense probably damaging 1.00
palms UTSW 11 68,377,448 (GRCm39) critical splice donor site probably null
piranha UTSW 11 68,377,407 (GRCm39) missense probably damaging 1.00
Serenoa_repens UTSW 11 68,366,250 (GRCm39) nonsense probably null
IGL02799:Pik3r5 UTSW 11 68,386,773 (GRCm39) missense probably damaging 0.98
R0077:Pik3r5 UTSW 11 68,377,448 (GRCm39) critical splice donor site probably null
R0092:Pik3r5 UTSW 11 68,383,629 (GRCm39) missense probably benign
R0105:Pik3r5 UTSW 11 68,381,337 (GRCm39) missense probably damaging 0.99
R0118:Pik3r5 UTSW 11 68,381,306 (GRCm39) missense probably damaging 1.00
R1204:Pik3r5 UTSW 11 68,385,050 (GRCm39) missense probably benign 0.03
R1447:Pik3r5 UTSW 11 68,385,003 (GRCm39) missense probably benign 0.18
R1865:Pik3r5 UTSW 11 68,383,318 (GRCm39) missense probably damaging 1.00
R2034:Pik3r5 UTSW 11 68,384,403 (GRCm39) missense probably damaging 0.99
R2356:Pik3r5 UTSW 11 68,383,743 (GRCm39) missense probably damaging 1.00
R4588:Pik3r5 UTSW 11 68,384,087 (GRCm39) intron probably benign
R4716:Pik3r5 UTSW 11 68,386,030 (GRCm39) missense possibly damaging 0.48
R4960:Pik3r5 UTSW 11 68,384,464 (GRCm39) missense probably benign 0.19
R5217:Pik3r5 UTSW 11 68,382,790 (GRCm39) missense possibly damaging 0.67
R5518:Pik3r5 UTSW 11 68,368,294 (GRCm39) missense possibly damaging 0.86
R5528:Pik3r5 UTSW 11 68,386,803 (GRCm39) missense probably damaging 1.00
R5554:Pik3r5 UTSW 11 68,385,059 (GRCm39) missense probably damaging 1.00
R5841:Pik3r5 UTSW 11 68,383,096 (GRCm39) missense probably damaging 1.00
R6025:Pik3r5 UTSW 11 68,383,144 (GRCm39) missense probably damaging 0.97
R6168:Pik3r5 UTSW 11 68,383,501 (GRCm39) missense probably benign
R6243:Pik3r5 UTSW 11 68,382,826 (GRCm39) missense probably damaging 1.00
R6322:Pik3r5 UTSW 11 68,383,567 (GRCm39) missense probably benign
R6420:Pik3r5 UTSW 11 68,366,250 (GRCm39) nonsense probably null
R6505:Pik3r5 UTSW 11 68,383,615 (GRCm39) missense probably benign 0.16
R6534:Pik3r5 UTSW 11 68,381,443 (GRCm39) missense possibly damaging 0.59
R6817:Pik3r5 UTSW 11 68,377,407 (GRCm39) missense probably damaging 1.00
R7246:Pik3r5 UTSW 11 68,383,769 (GRCm39) missense probably benign 0.01
R7459:Pik3r5 UTSW 11 68,383,416 (GRCm39) missense probably benign 0.03
R7527:Pik3r5 UTSW 11 68,367,177 (GRCm39) missense probably damaging 1.00
R7739:Pik3r5 UTSW 11 68,381,324 (GRCm39) missense probably damaging 1.00
R7817:Pik3r5 UTSW 11 68,384,483 (GRCm39) missense probably damaging 0.99
R7877:Pik3r5 UTSW 11 68,381,431 (GRCm39) missense probably damaging 1.00
R7885:Pik3r5 UTSW 11 68,383,528 (GRCm39) missense possibly damaging 0.57
R7960:Pik3r5 UTSW 11 68,386,796 (GRCm39) missense probably benign 0.22
R8816:Pik3r5 UTSW 11 68,385,060 (GRCm39) missense probably damaging 1.00
R8836:Pik3r5 UTSW 11 68,385,104 (GRCm39) missense probably benign 0.06
R9131:Pik3r5 UTSW 11 68,383,099 (GRCm39) missense possibly damaging 0.64
R9649:Pik3r5 UTSW 11 68,381,720 (GRCm39) missense probably benign 0.00
R9706:Pik3r5 UTSW 11 68,381,426 (GRCm39) missense probably benign 0.00
Z1177:Pik3r5 UTSW 11 68,383,722 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TGATACATTGGGCTCCCTGC -3'
(R):5'- ACGAAAGTCAGTGTGGGACC -3'

Sequencing Primer
(F):5'- TGCCCAACACTGTGTCCAG -3'
(R):5'- TCAGTGTGGGACCCCGTG -3'
Posted On 2016-11-09