Incidental Mutation 'R5694:Sos2'
ID443836
Institutional Source Beutler Lab
Gene Symbol Sos2
Ensembl Gene ENSMUSG00000034801
Gene NameSOS Ras/Rho guanine nucleotide exchange factor 2
Synonyms
MMRRC Submission 043325-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5694 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location69583762-69681852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 69590915 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 1007 (R1007S)
Ref Sequence ENSEMBL: ENSMUSP00000138589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035773] [ENSMUST00000182396] [ENSMUST00000183277]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035773
AA Change: R1039S

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044866
Gene: ENSMUSG00000034801
AA Change: R1039S

DomainStartEndE-ValueType
Pfam:Histone 54 169 3.7e-13 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182123
Predicted Effect probably damaging
Transcript: ENSMUST00000182396
AA Change: R1007S

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138589
Gene: ENSMUSG00000034801
AA Change: R1007S

DomainStartEndE-ValueType
Pfam:Histone 97 169 1e-9 PFAM
Pfam:RhoGEF 203 344 1.6e-12 PFAM
PH 410 514 1.54e-14 SMART
RasGEFN 562 707 5.8e-52 SMART
RasGEF 742 986 2.51e-92 SMART
low complexity region 1046 1066 N/A INTRINSIC
low complexity region 1111 1119 N/A INTRINSIC
low complexity region 1140 1159 N/A INTRINSIC
low complexity region 1167 1192 N/A INTRINSIC
low complexity region 1221 1236 N/A INTRINSIC
low complexity region 1243 1259 N/A INTRINSIC
low complexity region 1268 1276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182838
Predicted Effect possibly damaging
Transcript: ENSMUST00000183277
AA Change: R1040S

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138793
Gene: ENSMUSG00000034801
AA Change: R1040S

DomainStartEndE-ValueType
Pfam:Histone 97 169 8.9e-11 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory protein that is involved in the positive regulation of ras proteins. Mutations in this gene are associated with Noonan Syndrome-9. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal embryonic and adult histopathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,600,947 I1353N probably damaging Het
Actr1a C A 19: 46,395,718 probably benign Het
Adamts14 A T 10: 61,229,652 M356K probably benign Het
Adamtsl2 A G 2: 27,081,724 H7R probably benign Het
Angptl2 T C 2: 33,228,616 V134A probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Astn2 T C 4: 65,950,138 D488G probably damaging Het
Cat A T 2: 103,472,994 V146E probably damaging Het
Dmxl1 T C 18: 49,894,257 V2144A probably damaging Het
Efcab5 T G 11: 77,188,875 D15A probably benign Het
Epha10 C T 4: 124,902,653 A385V unknown Het
Erg C A 16: 95,361,031 E388D probably benign Het
Fam126a C A 5: 23,991,796 L31F probably damaging Het
Fbxo10 T A 4: 45,035,970 I931F probably damaging Het
Frem1 A G 4: 82,994,116 L673P probably damaging Het
Gm4922 A C 10: 18,784,287 I229S possibly damaging Het
Gnptab T A 10: 88,414,486 D153E probably benign Het
Htr7 T C 19: 36,057,121 M45V probably benign Het
Igkv4-51 C T 6: 69,681,927 V5M probably damaging Het
Ints7 G A 1: 191,586,618 E156K probably damaging Het
Map3k21 A G 8: 125,944,768 T932A probably benign Het
Mapk1 T G 16: 17,018,469 D160E probably benign Het
Mast4 A T 13: 102,774,193 Y479* probably null Het
Meig1 T A 2: 3,411,962 K7N probably damaging Het
Mthfd1l T A 10: 4,035,239 D548E possibly damaging Het
Myo16 A G 8: 10,569,606 R1386G probably benign Het
Nphs2 T C 1: 156,326,037 S353P probably benign Het
Olfr533 T C 7: 140,466,731 F177L probably benign Het
Olfr906 T A 9: 38,488,236 I69K probably damaging Het
Pcdha9 G T 18: 36,998,372 V165L probably benign Het
Pde3a T A 6: 141,250,502 S305T possibly damaging Het
Phf14 C A 6: 11,990,125 L718I possibly damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Rab44 T C 17: 29,140,500 L554P probably damaging Het
Rab44 T A 17: 29,145,966 M645K unknown Het
Rnf222 A G 11: 68,892,897 T97A probably benign Het
Rnpepl1 T C 1: 92,918,941 S522P probably benign Het
Serinc5 A G 13: 92,688,794 I244V probably benign Het
Serpinb10 A T 1: 107,535,457 probably null Het
Siglech T A 7: 55,768,656 F124Y probably damaging Het
Smarcc2 A T 10: 128,484,127 I790L probably benign Het
Stk4 C T 2: 164,100,564 T372M possibly damaging Het
Tbc1d10c A T 19: 4,184,964 L366H probably damaging Het
Tor4a T C 2: 25,194,920 T324A probably benign Het
Trim12a C A 7: 104,307,243 C30F probably damaging Het
Ttll3 G A 6: 113,399,708 V350M probably damaging Het
Uggt1 A T 1: 36,179,656 D63E probably damaging Het
Unc5b G A 10: 60,773,747 T590I probably benign Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls A C 3: 159,839,987 I16L probably benign Het
Zfp101 T C 17: 33,380,945 I612M probably benign Het
Zfp677 C A 17: 21,397,759 D359E probably damaging Het
Other mutations in Sos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Sos2 APN 12 69616849 splice site probably benign
IGL01348:Sos2 APN 12 69618092 missense probably damaging 0.99
IGL01360:Sos2 APN 12 69590800 missense probably benign 0.00
IGL01586:Sos2 APN 12 69607398 missense probably damaging 1.00
IGL01721:Sos2 APN 12 69603867 missense probably damaging 0.99
IGL02024:Sos2 APN 12 69618048 splice site probably benign
IGL02347:Sos2 APN 12 69596746 missense probably benign
IGL02419:Sos2 APN 12 69616990 missense probably benign
IGL02684:Sos2 APN 12 69596666 missense probably damaging 1.00
IGL02719:Sos2 APN 12 69617184 missense probably benign 0.00
IGL03099:Sos2 APN 12 69616359 missense probably damaging 1.00
PIT4131001:Sos2 UTSW 12 69618077 missense probably benign
R0038:Sos2 UTSW 12 69596693 missense probably damaging 1.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0326:Sos2 UTSW 12 69635685 missense probably damaging 1.00
R1386:Sos2 UTSW 12 69614658 missense probably damaging 1.00
R1472:Sos2 UTSW 12 69585316 unclassified probably null
R1534:Sos2 UTSW 12 69616955 missense probably damaging 1.00
R1861:Sos2 UTSW 12 69617363 missense probably damaging 1.00
R1934:Sos2 UTSW 12 69648541 missense probably damaging 0.99
R1964:Sos2 UTSW 12 69616862 missense possibly damaging 0.51
R2402:Sos2 UTSW 12 69596799 missense possibly damaging 0.95
R2516:Sos2 UTSW 12 69650659 missense probably damaging 0.99
R2571:Sos2 UTSW 12 69635718 missense possibly damaging 0.95
R3423:Sos2 UTSW 12 69603553 missense probably damaging 1.00
R4435:Sos2 UTSW 12 69614699 missense possibly damaging 0.79
R4508:Sos2 UTSW 12 69635661 nonsense probably null
R4595:Sos2 UTSW 12 69616889 missense probably damaging 1.00
R4606:Sos2 UTSW 12 69614606 intron probably benign
R4691:Sos2 UTSW 12 69616328 missense probably damaging 1.00
R4716:Sos2 UTSW 12 69607371 missense probably benign 0.04
R4863:Sos2 UTSW 12 69640154 missense probably benign 0.04
R5179:Sos2 UTSW 12 69650728 nonsense probably null
R5319:Sos2 UTSW 12 69627284 missense probably benign 0.22
R5877:Sos2 UTSW 12 69596795 missense probably damaging 1.00
R6363:Sos2 UTSW 12 69632111 missense probably benign 0.00
R6465:Sos2 UTSW 12 69596775 missense probably benign 0.01
R6817:Sos2 UTSW 12 69618161 missense probably benign 0.32
R6822:Sos2 UTSW 12 69650649 missense probably damaging 1.00
R7015:Sos2 UTSW 12 69585235 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CATACTTACCACAGGAGCTATTGAG -3'
(R):5'- ACAAGAAATGCTACAGGCTGTCC -3'

Sequencing Primer
(F):5'- TCTAGAAACACGCTGTGGTC -3'
(R):5'- ACAGGCTGTCCTTGAAGATC -3'
Posted On2016-11-09