Incidental Mutation 'R5695:Sulf2'
ID443860
Institutional Source Beutler Lab
Gene Symbol Sulf2
Ensembl Gene ENSMUSG00000006800
Gene Namesulfatase 2
Synonyms2010004N24Rik
MMRRC Submission 043326-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.435) question?
Stock #R5695 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location166073089-166155663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 166132758 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 2 (A2V)
Ref Sequence ENSEMBL: ENSMUSP00000154315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088086] [ENSMUST00000109249] [ENSMUST00000133395] [ENSMUST00000139266] [ENSMUST00000146497]
Predicted Effect probably benign
Transcript: ENSMUST00000088086
AA Change: A2V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085405
Gene: ENSMUSG00000006800
AA Change: A2V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sulfatase 44 375 2.8e-50 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 669 5.6e-47 PFAM
low complexity region 702 720 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109249
AA Change: A2V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104872
Gene: ENSMUSG00000006800
AA Change: A2V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sulfatase 44 375 2.8e-50 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 532 670 1.3e-46 PFAM
low complexity region 702 720 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000133395
AA Change: A2V
Predicted Effect probably benign
Transcript: ENSMUST00000139266
AA Change: A2V

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000146497
AA Change: A2V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate proteoglycans (HSPGs) act as coreceptors for numerous heparin-binding growth factors and cytokines and are involved in cell signaling. Heparan sulfate 6-O-endosulfatases, such as SULF2, selectively remove 6-O-sulfate groups from heparan sulfate. This activity modulates the effects of heparan sulfate by altering binding sites for signaling molecules (Dai et al., 2005 [PubMed 16192265]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous disruption of this gene may lead to a partially penetrant, strain-dependent phenotype of embryonic lethality, reduced postnatal body weight, lung abnormalities, brain malformations, and reduced fertility. Mice homozygous for a hypomorphic gene-trap allele display skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,613,971 H116L probably damaging Het
Anapc4 C T 5: 52,862,239 S581L probably benign Het
Ano8 A C 8: 71,483,243 D276E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Bpifb4 G A 2: 153,942,923 G184S probably damaging Het
Cbx8 T C 11: 119,039,311 D152G probably benign Het
Cdca2 A G 14: 67,705,629 probably null Het
Cgn G A 3: 94,773,635 A531V probably benign Het
Cmya5 C A 13: 93,045,866 probably null Het
Cntnap3 A G 13: 64,787,955 S365P probably damaging Het
Crnn A G 3: 93,149,023 Q372R probably damaging Het
Ehf T A 2: 103,266,779 E276V probably damaging Het
Eif4g3 T A 4: 138,163,433 probably null Het
Enpep C T 3: 129,309,099 D403N probably damaging Het
Enpp1 T C 10: 24,654,908 E550G probably damaging Het
Entpd8 A G 2: 25,084,334 D377G probably benign Het
Epc2 T A 2: 49,547,607 probably null Het
Erich3 G T 3: 154,733,573 G481V probably damaging Het
Fank1 A G 7: 133,869,346 Y156C probably damaging Het
Fras1 A G 5: 96,781,344 D3869G probably damaging Het
Gcnt2 A G 13: 40,918,199 D106G probably benign Het
Gm20830 A T Y: 6,916,501 V206E probably benign Het
Gmpr2 T C 14: 55,677,234 V228A possibly damaging Het
Gon4l TGAGCA TGAGCAGAGCA 3: 88,896,216 probably null Het
Gtpbp1 G A 15: 79,712,174 probably null Het
Hhat A T 1: 192,717,019 M271K probably damaging Het
Hipk2 A T 6: 38,818,875 M153K possibly damaging Het
Hydin A T 8: 110,535,283 H2672L probably benign Het
Igfbpl1 A T 4: 45,826,374 D140E probably damaging Het
Kctd1 T G 18: 15,063,516 probably benign Het
Lax1 A T 1: 133,680,578 Y142N probably damaging Het
Lpin2 C T 17: 71,244,803 R733C probably damaging Het
Morn4 A G 19: 42,076,117 L144P possibly damaging Het
Nup214 C A 2: 32,034,373 T1638K probably damaging Het
Nyap1 C T 5: 137,734,984 A596T probably damaging Het
Oas1d T C 5: 120,915,011 M43T probably benign Het
Olfr724 T C 14: 49,960,623 T150A probably benign Het
Olfr901 A G 9: 38,431,176 H298R probably benign Het
Olfr986 T C 9: 40,187,601 V162A probably benign Het
Pacs1 A G 19: 5,136,791 F851S probably damaging Het
Pcdh17 A G 14: 84,446,360 Q89R probably damaging Het
Phrf1 A G 7: 141,258,465 probably benign Het
Plekhb1 A T 7: 100,655,395 I34N probably damaging Het
Ralgapa2 T C 2: 146,333,477 E1800G probably damaging Het
Rbm33 A T 5: 28,339,012 I89F probably damaging Het
Rtl1 T A 12: 109,594,097 E436V probably damaging Het
Slc2a4 G T 11: 69,946,391 P73Q probably damaging Het
Sorbs2 A T 8: 45,792,875 T311S probably benign Het
Supt16 A T 14: 52,174,144 probably null Het
Vmn1r26 A T 6: 58,008,753 N150K probably damaging Het
Vmn2r39 T A 7: 9,025,151 H407L possibly damaging Het
Vmn2r84 T A 10: 130,389,195 Y482F probably benign Het
Vps9d1 T C 8: 123,246,916 E376G probably benign Het
Wrn C A 8: 33,324,318 G366V probably benign Het
Other mutations in Sulf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Sulf2 APN 2 166094492 missense possibly damaging 0.48
IGL01353:Sulf2 APN 2 166087095 missense probably damaging 1.00
IGL02427:Sulf2 APN 2 166089298 missense probably damaging 0.99
IGL02602:Sulf2 APN 2 166081300 missense probably benign 0.32
IGL02681:Sulf2 APN 2 166116985 missense probably benign 0.01
IGL03047:Sulf2 APN 2 166080894 splice site probably null
PIT4468001:Sulf2 UTSW 2 166080800 missense probably benign
R0029:Sulf2 UTSW 2 166116973 missense possibly damaging 0.46
R0029:Sulf2 UTSW 2 166116973 missense possibly damaging 0.46
R0233:Sulf2 UTSW 2 166085669 splice site probably benign
R0332:Sulf2 UTSW 2 166089199 missense probably benign 0.00
R0411:Sulf2 UTSW 2 166093516 missense probably damaging 1.00
R0599:Sulf2 UTSW 2 166083879 missense possibly damaging 0.53
R0694:Sulf2 UTSW 2 166085791 missense probably damaging 1.00
R1594:Sulf2 UTSW 2 166084447 splice site probably benign
R1710:Sulf2 UTSW 2 166079072 missense probably benign
R1725:Sulf2 UTSW 2 166081361 missense probably damaging 0.96
R1737:Sulf2 UTSW 2 166082678 missense probably benign 0.01
R1775:Sulf2 UTSW 2 166079612 missense probably benign 0.07
R2001:Sulf2 UTSW 2 166080853 missense probably benign 0.05
R2570:Sulf2 UTSW 2 166085801 missense probably benign 0.21
R4052:Sulf2 UTSW 2 166094590 missense probably damaging 1.00
R4357:Sulf2 UTSW 2 166077577 missense probably benign 0.01
R4613:Sulf2 UTSW 2 166132605 missense probably damaging 1.00
R4790:Sulf2 UTSW 2 166089295 missense probably damaging 1.00
R4858:Sulf2 UTSW 2 166081604 missense probably benign 0.00
R5033:Sulf2 UTSW 2 166081622 missense probably benign 0.01
R5692:Sulf2 UTSW 2 166081506 missense probably benign 0.03
R6504:Sulf2 UTSW 2 166083921 missense probably benign 0.00
R6816:Sulf2 UTSW 2 166082754 missense probably benign
R6859:Sulf2 UTSW 2 166087119 missense probably damaging 1.00
R6873:Sulf2 UTSW 2 166089275 missense probably damaging 0.97
R7125:Sulf2 UTSW 2 166075528 nonsense probably null
X0063:Sulf2 UTSW 2 166079133 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACATGGTTCTTCTAGAGCCCC -3'
(R):5'- TCCTTGTGTGAGGCAGCATG -3'

Sequencing Primer
(F):5'- GTTCTTCTAGAGCCCCAGGTG -3'
(R):5'- GCAGCATGCAAGCCCAG -3'
Posted On2016-11-09