Incidental Mutation 'R5695:Enpep'
ID443865
Institutional Source Beutler Lab
Gene Symbol Enpep
Ensembl Gene ENSMUSG00000028024
Gene Nameglutamyl aminopeptidase
SynonymsLy51, aminopeptidase-A, Bp-1/6C3, 6030431M22Rik, APA, Ly-51
MMRRC Submission 043326-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5695 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location129269175-129332720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 129309099 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 403 (D403N)
Ref Sequence ENSEMBL: ENSMUSP00000029658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029658]
Predicted Effect probably damaging
Transcript: ENSMUST00000029658
AA Change: D403N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029658
Gene: ENSMUSG00000028024
AA Change: D403N

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:Peptidase_M1 84 474 6e-147 PFAM
Pfam:ERAP1_C 607 925 1e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165217
Predicted Effect probably benign
Transcript: ENSMUST00000169240
SMART Domains Protein: ENSMUSP00000129759
Gene: ENSMUSG00000028024

DomainStartEndE-ValueType
Pfam:Peptidase_M1 1 51 1.5e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170918
AA Change: D330N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128872
Gene: ENSMUSG00000028024
AA Change: D330N

DomainStartEndE-ValueType
Pfam:Peptidase_M1 12 402 9.6e-148 PFAM
Meta Mutation Damage Score 0.204 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 98% (58/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and morphologically unaffected with normal B and T cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,613,971 H116L probably damaging Het
Anapc4 C T 5: 52,862,239 S581L probably benign Het
Ano8 A C 8: 71,483,243 D276E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Bpifb4 G A 2: 153,942,923 G184S probably damaging Het
Cbx8 T C 11: 119,039,311 D152G probably benign Het
Cdca2 A G 14: 67,705,629 probably null Het
Cgn G A 3: 94,773,635 A531V probably benign Het
Cmya5 C A 13: 93,045,866 probably null Het
Cntnap3 A G 13: 64,787,955 S365P probably damaging Het
Crnn A G 3: 93,149,023 Q372R probably damaging Het
Ehf T A 2: 103,266,779 E276V probably damaging Het
Eif4g3 T A 4: 138,163,433 probably null Het
Enpp1 T C 10: 24,654,908 E550G probably damaging Het
Entpd8 A G 2: 25,084,334 D377G probably benign Het
Epc2 T A 2: 49,547,607 probably null Het
Erich3 G T 3: 154,733,573 G481V probably damaging Het
Fank1 A G 7: 133,869,346 Y156C probably damaging Het
Fras1 A G 5: 96,781,344 D3869G probably damaging Het
Gcnt2 A G 13: 40,918,199 D106G probably benign Het
Gm20830 A T Y: 6,916,501 V206E probably benign Het
Gmpr2 T C 14: 55,677,234 V228A possibly damaging Het
Gon4l TGAGCA TGAGCAGAGCA 3: 88,896,216 probably null Het
Gtpbp1 G A 15: 79,712,174 probably null Het
Hhat A T 1: 192,717,019 M271K probably damaging Het
Hipk2 A T 6: 38,818,875 M153K possibly damaging Het
Hydin A T 8: 110,535,283 H2672L probably benign Het
Igfbpl1 A T 4: 45,826,374 D140E probably damaging Het
Kctd1 T G 18: 15,063,516 probably benign Het
Lax1 A T 1: 133,680,578 Y142N probably damaging Het
Lpin2 C T 17: 71,244,803 R733C probably damaging Het
Morn4 A G 19: 42,076,117 L144P possibly damaging Het
Nup214 C A 2: 32,034,373 T1638K probably damaging Het
Nyap1 C T 5: 137,734,984 A596T probably damaging Het
Oas1d T C 5: 120,915,011 M43T probably benign Het
Olfr724 T C 14: 49,960,623 T150A probably benign Het
Olfr901 A G 9: 38,431,176 H298R probably benign Het
Olfr986 T C 9: 40,187,601 V162A probably benign Het
Pacs1 A G 19: 5,136,791 F851S probably damaging Het
Pcdh17 A G 14: 84,446,360 Q89R probably damaging Het
Phrf1 A G 7: 141,258,465 probably benign Het
Plekhb1 A T 7: 100,655,395 I34N probably damaging Het
Ralgapa2 T C 2: 146,333,477 E1800G probably damaging Het
Rbm33 A T 5: 28,339,012 I89F probably damaging Het
Rtl1 T A 12: 109,594,097 E436V probably damaging Het
Slc2a4 G T 11: 69,946,391 P73Q probably damaging Het
Sorbs2 A T 8: 45,792,875 T311S probably benign Het
Sulf2 G A 2: 166,132,758 A2V probably benign Het
Supt16 A T 14: 52,174,144 probably null Het
Vmn1r26 A T 6: 58,008,753 N150K probably damaging Het
Vmn2r39 T A 7: 9,025,151 H407L possibly damaging Het
Vmn2r84 T A 10: 130,389,195 Y482F probably benign Het
Vps9d1 T C 8: 123,246,916 E376G probably benign Het
Wrn C A 8: 33,324,318 G366V probably benign Het
Other mutations in Enpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Enpep APN 3 129332082 missense possibly damaging 0.69
IGL01895:Enpep APN 3 129270334 missense possibly damaging 0.89
IGL02193:Enpep APN 3 129281687 missense possibly damaging 0.46
IGL02215:Enpep APN 3 129270277 splice site probably benign
IGL02511:Enpep APN 3 129321410 missense probably damaging 1.00
IGL02579:Enpep APN 3 129284090 missense probably benign 0.07
IGL02634:Enpep APN 3 129309857 missense probably damaging 1.00
IGL03034:Enpep APN 3 129298950 missense probably damaging 0.99
IGL03214:Enpep APN 3 129293247 missense probably benign
IGL03401:Enpep APN 3 129312620 missense probably benign 0.01
P0041:Enpep UTSW 3 129332198 missense possibly damaging 0.80
R0371:Enpep UTSW 3 129283867 critical splice donor site probably null
R0479:Enpep UTSW 3 129312674 missense possibly damaging 0.65
R1036:Enpep UTSW 3 129284109 missense probably damaging 0.99
R1466:Enpep UTSW 3 129319448 missense probably damaging 1.00
R1466:Enpep UTSW 3 129319448 missense probably damaging 1.00
R1584:Enpep UTSW 3 129319448 missense probably damaging 1.00
R2060:Enpep UTSW 3 129280523 missense probably benign 0.14
R2101:Enpep UTSW 3 129298938 missense probably benign 0.00
R2153:Enpep UTSW 3 129280582 missense probably damaging 0.99
R2474:Enpep UTSW 3 129284158 missense possibly damaging 0.77
R3618:Enpep UTSW 3 129284158 missense possibly damaging 0.77
R3619:Enpep UTSW 3 129284158 missense possibly damaging 0.77
R4275:Enpep UTSW 3 129332278 missense probably benign 0.02
R4291:Enpep UTSW 3 129270317 nonsense probably null
R4438:Enpep UTSW 3 129284091 missense possibly damaging 0.94
R4570:Enpep UTSW 3 129281548 missense possibly damaging 0.67
R4678:Enpep UTSW 3 129303713 critical splice donor site probably null
R4679:Enpep UTSW 3 129303713 critical splice donor site probably null
R4748:Enpep UTSW 3 129332163 missense probably damaging 1.00
R4878:Enpep UTSW 3 129276771 missense probably benign 0.17
R4954:Enpep UTSW 3 129284180 missense probably damaging 0.98
R5074:Enpep UTSW 3 129303755 missense probably damaging 1.00
R5261:Enpep UTSW 3 129305426 missense probably damaging 1.00
R5328:Enpep UTSW 3 129280510 missense probably benign 0.30
R5661:Enpep UTSW 3 129276757 missense probably damaging 0.98
R5687:Enpep UTSW 3 129299094 splice site probably null
R5697:Enpep UTSW 3 129309123 missense probably benign
R5889:Enpep UTSW 3 129312578 missense probably damaging 1.00
R5940:Enpep UTSW 3 129312578 missense probably damaging 1.00
R5968:Enpep UTSW 3 129280938 missense probably benign
R5976:Enpep UTSW 3 129299124 missense probably damaging 0.97
R6151:Enpep UTSW 3 129332418 missense possibly damaging 0.82
R6367:Enpep UTSW 3 129332081 missense possibly damaging 0.94
R6468:Enpep UTSW 3 129331860 critical splice donor site probably null
R6484:Enpep UTSW 3 129321481 missense probably damaging 0.96
R6938:Enpep UTSW 3 129298950 missense probably damaging 0.99
R6989:Enpep UTSW 3 129280950 missense probably damaging 1.00
R7073:Enpep UTSW 3 129312670 nonsense probably null
R7258:Enpep UTSW 3 129332075 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGGTAAAGGCTCTTGGCAAAG -3'
(R):5'- CCTCAAATCAAGATGAAGTGGG -3'

Sequencing Primer
(F):5'- CTGACTACCTTCACAACGGATATTTG -3'
(R):5'- TGAAGTGGGAAATACATGTTAGGTAC -3'
Posted On2016-11-09