Incidental Mutation 'R5695:Vps9d1'
ID443886
Institutional Source Beutler Lab
Gene Symbol Vps9d1
Ensembl Gene ENSMUSG00000001062
Gene NameVPS9 domain containing 1
Synonyms
MMRRC Submission 043326-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R5695 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location123242356-123254348 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123246916 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 376 (E376G)
Ref Sequence ENSEMBL: ENSMUSP00000113575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117643] [ENSMUST00000118279] [ENSMUST00000122363] [ENSMUST00000127664] [ENSMUST00000155869]
Predicted Effect probably benign
Transcript: ENSMUST00000117643
AA Change: E376G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113748
Gene: ENSMUSG00000001062
AA Change: E376G

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 645 8.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118279
AA Change: E376G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113634
Gene: ENSMUSG00000001062
AA Change: E376G

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 645 1.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122363
AA Change: E376G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113575
Gene: ENSMUSG00000001062
AA Change: E376G

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 644 5.6e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124508
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155853
Predicted Effect probably benign
Transcript: ENSMUST00000155869
SMART Domains Protein: ENSMUSP00000122184
Gene: ENSMUSG00000001062

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211876
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,613,971 H116L probably damaging Het
Anapc4 C T 5: 52,862,239 S581L probably benign Het
Ano8 A C 8: 71,483,243 D276E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Bpifb4 G A 2: 153,942,923 G184S probably damaging Het
Cbx8 T C 11: 119,039,311 D152G probably benign Het
Cdca2 A G 14: 67,705,629 probably null Het
Cgn G A 3: 94,773,635 A531V probably benign Het
Cmya5 C A 13: 93,045,866 probably null Het
Cntnap3 A G 13: 64,787,955 S365P probably damaging Het
Crnn A G 3: 93,149,023 Q372R probably damaging Het
Ehf T A 2: 103,266,779 E276V probably damaging Het
Eif4g3 T A 4: 138,163,433 probably null Het
Enpep C T 3: 129,309,099 D403N probably damaging Het
Enpp1 T C 10: 24,654,908 E550G probably damaging Het
Entpd8 A G 2: 25,084,334 D377G probably benign Het
Epc2 T A 2: 49,547,607 probably null Het
Erich3 G T 3: 154,733,573 G481V probably damaging Het
Fank1 A G 7: 133,869,346 Y156C probably damaging Het
Fras1 A G 5: 96,781,344 D3869G probably damaging Het
Gcnt2 A G 13: 40,918,199 D106G probably benign Het
Gm20830 A T Y: 6,916,501 V206E probably benign Het
Gmpr2 T C 14: 55,677,234 V228A possibly damaging Het
Gon4l TGAGCA TGAGCAGAGCA 3: 88,896,216 probably null Het
Gtpbp1 G A 15: 79,712,174 probably null Het
Hhat A T 1: 192,717,019 M271K probably damaging Het
Hipk2 A T 6: 38,818,875 M153K possibly damaging Het
Hydin A T 8: 110,535,283 H2672L probably benign Het
Igfbpl1 A T 4: 45,826,374 D140E probably damaging Het
Kctd1 T G 18: 15,063,516 probably benign Het
Lax1 A T 1: 133,680,578 Y142N probably damaging Het
Lpin2 C T 17: 71,244,803 R733C probably damaging Het
Morn4 A G 19: 42,076,117 L144P possibly damaging Het
Nup214 C A 2: 32,034,373 T1638K probably damaging Het
Nyap1 C T 5: 137,734,984 A596T probably damaging Het
Oas1d T C 5: 120,915,011 M43T probably benign Het
Olfr724 T C 14: 49,960,623 T150A probably benign Het
Olfr901 A G 9: 38,431,176 H298R probably benign Het
Olfr986 T C 9: 40,187,601 V162A probably benign Het
Pacs1 A G 19: 5,136,791 F851S probably damaging Het
Pcdh17 A G 14: 84,446,360 Q89R probably damaging Het
Phrf1 A G 7: 141,258,465 probably benign Het
Plekhb1 A T 7: 100,655,395 I34N probably damaging Het
Ralgapa2 T C 2: 146,333,477 E1800G probably damaging Het
Rbm33 A T 5: 28,339,012 I89F probably damaging Het
Rtl1 T A 12: 109,594,097 E436V probably damaging Het
Slc2a4 G T 11: 69,946,391 P73Q probably damaging Het
Sorbs2 A T 8: 45,792,875 T311S probably benign Het
Sulf2 G A 2: 166,132,758 A2V probably benign Het
Supt16 A T 14: 52,174,144 probably null Het
Vmn1r26 A T 6: 58,008,753 N150K probably damaging Het
Vmn2r39 T A 7: 9,025,151 H407L possibly damaging Het
Vmn2r84 T A 10: 130,389,195 Y482F probably benign Het
Wrn C A 8: 33,324,318 G366V probably benign Het
Other mutations in Vps9d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Vps9d1 APN 8 123245198 missense probably damaging 1.00
IGL01112:Vps9d1 APN 8 123246030 missense probably damaging 1.00
IGL01729:Vps9d1 APN 8 123247000 missense probably damaging 1.00
R0568:Vps9d1 UTSW 8 123246748 missense probably damaging 1.00
R1191:Vps9d1 UTSW 8 123247967 missense possibly damaging 0.95
R1813:Vps9d1 UTSW 8 123247039 missense probably damaging 0.99
R1896:Vps9d1 UTSW 8 123247039 missense probably damaging 0.99
R2193:Vps9d1 UTSW 8 123252665 missense probably damaging 1.00
R2256:Vps9d1 UTSW 8 123245121 missense probably benign 0.18
R4305:Vps9d1 UTSW 8 123248237 intron probably benign
R4458:Vps9d1 UTSW 8 123247748 missense probably benign 0.30
R4707:Vps9d1 UTSW 8 123248612 critical splice donor site probably benign
R5366:Vps9d1 UTSW 8 123245114 missense possibly damaging 0.89
R5392:Vps9d1 UTSW 8 123254013 missense probably damaging 0.99
R5423:Vps9d1 UTSW 8 123247965 critical splice donor site probably null
R5645:Vps9d1 UTSW 8 123247748 missense probably benign 0.30
R5647:Vps9d1 UTSW 8 123248859 missense probably damaging 1.00
R5908:Vps9d1 UTSW 8 123246824 missense probably benign 0.28
R6061:Vps9d1 UTSW 8 123245671 missense probably damaging 0.99
R6250:Vps9d1 UTSW 8 123248208 critical splice acceptor site probably null
R6416:Vps9d1 UTSW 8 123248639 missense probably damaging 1.00
R6747:Vps9d1 UTSW 8 123254007 missense probably damaging 1.00
R7049:Vps9d1 UTSW 8 123247143 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACTGTGCTCTTCAGACACTCC -3'
(R):5'- TGTATCCGATTGTGAGCCGG -3'

Sequencing Primer
(F):5'- TCTTCAGACACTCCAACAAGGGTTC -3'
(R):5'- ATTGTGAGCCGGGCTGC -3'
Posted On2016-11-09