Incidental Mutation 'R5695:Olfr901'
ID443887
Institutional Source Beutler Lab
Gene Symbol Olfr901
Ensembl Gene ENSMUSG00000052058
Gene Nameolfactory receptor 901
SynonymsGA_x6K02T2PVTD-32123032-32123967, MOR162-8
MMRRC Submission 043326-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5695 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38429455-38432682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38431176 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 298 (H298R)
Ref Sequence ENSEMBL: ENSMUSP00000150506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063716] [ENSMUST00000216502] [ENSMUST00000216644]
Predicted Effect probably benign
Transcript: ENSMUST00000063716
AA Change: H298R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000066714
Gene: ENSMUSG00000052058
AA Change: H298R

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 4.2e-47 PFAM
Pfam:7tm_1 42 290 3.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216502
AA Change: H298R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000216644
AA Change: H298R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.1276 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,613,971 H116L probably damaging Het
Anapc4 C T 5: 52,862,239 S581L probably benign Het
Ano8 A C 8: 71,483,243 D276E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Bpifb4 G A 2: 153,942,923 G184S probably damaging Het
Cbx8 T C 11: 119,039,311 D152G probably benign Het
Cdca2 A G 14: 67,705,629 probably null Het
Cgn G A 3: 94,773,635 A531V probably benign Het
Cmya5 C A 13: 93,045,866 probably null Het
Cntnap3 A G 13: 64,787,955 S365P probably damaging Het
Crnn A G 3: 93,149,023 Q372R probably damaging Het
Ehf T A 2: 103,266,779 E276V probably damaging Het
Eif4g3 T A 4: 138,163,433 probably null Het
Enpep C T 3: 129,309,099 D403N probably damaging Het
Enpp1 T C 10: 24,654,908 E550G probably damaging Het
Entpd8 A G 2: 25,084,334 D377G probably benign Het
Epc2 T A 2: 49,547,607 probably null Het
Erich3 G T 3: 154,733,573 G481V probably damaging Het
Fank1 A G 7: 133,869,346 Y156C probably damaging Het
Fras1 A G 5: 96,781,344 D3869G probably damaging Het
Gcnt2 A G 13: 40,918,199 D106G probably benign Het
Gm20830 A T Y: 6,916,501 V206E probably benign Het
Gmpr2 T C 14: 55,677,234 V228A possibly damaging Het
Gon4l TGAGCA TGAGCAGAGCA 3: 88,896,216 probably null Het
Gtpbp1 G A 15: 79,712,174 probably null Het
Hhat A T 1: 192,717,019 M271K probably damaging Het
Hipk2 A T 6: 38,818,875 M153K possibly damaging Het
Hydin A T 8: 110,535,283 H2672L probably benign Het
Igfbpl1 A T 4: 45,826,374 D140E probably damaging Het
Kctd1 T G 18: 15,063,516 probably benign Het
Lax1 A T 1: 133,680,578 Y142N probably damaging Het
Lpin2 C T 17: 71,244,803 R733C probably damaging Het
Morn4 A G 19: 42,076,117 L144P possibly damaging Het
Nup214 C A 2: 32,034,373 T1638K probably damaging Het
Nyap1 C T 5: 137,734,984 A596T probably damaging Het
Oas1d T C 5: 120,915,011 M43T probably benign Het
Olfr724 T C 14: 49,960,623 T150A probably benign Het
Olfr986 T C 9: 40,187,601 V162A probably benign Het
Pacs1 A G 19: 5,136,791 F851S probably damaging Het
Pcdh17 A G 14: 84,446,360 Q89R probably damaging Het
Phrf1 A G 7: 141,258,465 probably benign Het
Plekhb1 A T 7: 100,655,395 I34N probably damaging Het
Ralgapa2 T C 2: 146,333,477 E1800G probably damaging Het
Rbm33 A T 5: 28,339,012 I89F probably damaging Het
Rtl1 T A 12: 109,594,097 E436V probably damaging Het
Slc2a4 G T 11: 69,946,391 P73Q probably damaging Het
Sorbs2 A T 8: 45,792,875 T311S probably benign Het
Sulf2 G A 2: 166,132,758 A2V probably benign Het
Supt16 A T 14: 52,174,144 probably null Het
Vmn1r26 A T 6: 58,008,753 N150K probably damaging Het
Vmn2r39 T A 7: 9,025,151 H407L possibly damaging Het
Vmn2r84 T A 10: 130,389,195 Y482F probably benign Het
Vps9d1 T C 8: 123,246,916 E376G probably benign Het
Wrn C A 8: 33,324,318 G366V probably benign Het
Other mutations in Olfr901
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Olfr901 APN 9 38430515 missense probably benign 0.20
IGL01875:Olfr901 APN 9 38430298 missense probably damaging 1.00
R0010:Olfr901 UTSW 9 38430920 missense possibly damaging 0.70
R1186:Olfr901 UTSW 9 38431101 missense possibly damaging 0.85
R1259:Olfr901 UTSW 9 38430873 missense probably damaging 0.99
R1273:Olfr901 UTSW 9 38430684 missense probably benign 0.05
R1475:Olfr901 UTSW 9 38430864 missense probably benign 0.30
R1530:Olfr901 UTSW 9 38430324 missense probably damaging 0.97
R1591:Olfr901 UTSW 9 38430411 missense probably damaging 1.00
R1750:Olfr901 UTSW 9 38430690 missense probably damaging 1.00
R1756:Olfr901 UTSW 9 38430995 missense probably benign
R2080:Olfr901 UTSW 9 38431082 missense probably benign 0.01
R3081:Olfr901 UTSW 9 38431056 missense possibly damaging 0.82
R4174:Olfr901 UTSW 9 38431020 missense probably damaging 0.97
R4299:Olfr901 UTSW 9 38430812 missense probably damaging 1.00
R4898:Olfr901 UTSW 9 38430815 missense probably benign 0.01
R5068:Olfr901 UTSW 9 38430464 missense probably damaging 1.00
R5973:Olfr901 UTSW 9 38430331 missense probably damaging 0.99
R6929:Olfr901 UTSW 9 38431148 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GTTCCACTGAAGGCAGATCC -3'
(R):5'- AGTGGCTTAATCTGTGAACGG -3'

Sequencing Primer
(F):5'- CAAGGCTATTAGTACCTGTAGCTCG -3'
(R):5'- AATCTGTGAACGGTTTTGCAC -3'
Posted On2016-11-09