Incidental Mutation 'R5695:Enpp1'
ID443890
Institutional Source Beutler Lab
Gene Symbol Enpp1
Ensembl Gene ENSMUSG00000037370
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 1
SynonymsPC-1, Npps, E-NPP1, Pca-1, twy, NPP1, 4833416E15Rik, Pdnp1, Pca, CD203c, Ly-41
MMRRC Submission 043326-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R5695 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location24637914-24712159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24654908 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 550 (E550G)
Ref Sequence ENSEMBL: ENSMUSP00000114273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039882] [ENSMUST00000105520] [ENSMUST00000135846]
Predicted Effect probably benign
Transcript: ENSMUST00000039882
SMART Domains Protein: ENSMUSP00000046090
Gene: ENSMUSG00000037370

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 59 69 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 358 1e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105520
AA Change: E550G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101159
Gene: ENSMUSG00000037370
AA Change: E550G

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 1.8e-87 PFAM
Endonuclease_NS 655 873 5.33e-15 SMART
NUC 656 887 3.62e-107 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135846
AA Change: E550G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114273
Gene: ENSMUSG00000037370
AA Change: E550G

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 4.2e-91 PFAM
Endonuclease_NS 656 874 5.33e-15 SMART
NUC 657 888 3.62e-107 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150570
Meta Mutation Damage Score 0.55 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: This gene encodes a member of the nucleoside pyrophosphatase/phosphodiesterase family of enzymes that catalyzes the hydrolysis of pyrophosphate and phosphodiester bonds in nucleotide triphosphates and oligonucleotides, respectively, to generate nucleoside 5'-monophosphates. The encoded protein is a type II transmembrane glycoprotein that negatively regulates bone mineralization. Mice harboring a nonsense mutation in this gene, termed tiptoe walking (ttw), exhibit ectopic ossification of the spinal ligaments. The encoded protein binds to the insulin receptor, inhibits downstream signaling events and induces insulin resistance and glucose tolerance. This gene is located adjacent to a paralog on chromosome 10. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele develop hyperostosis leading to ossific intervertebral fusion, peripheral joint ankylosis and tendon calcification, and display spontaneous arterial and articular cartilage calcification, and altered adipocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,613,971 H116L probably damaging Het
Anapc4 C T 5: 52,862,239 S581L probably benign Het
Ano8 A C 8: 71,483,243 D276E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Bpifb4 G A 2: 153,942,923 G184S probably damaging Het
Cbx8 T C 11: 119,039,311 D152G probably benign Het
Cdca2 A G 14: 67,705,629 probably null Het
Cgn G A 3: 94,773,635 A531V probably benign Het
Cmya5 C A 13: 93,045,866 probably null Het
Cntnap3 A G 13: 64,787,955 S365P probably damaging Het
Crnn A G 3: 93,149,023 Q372R probably damaging Het
Ehf T A 2: 103,266,779 E276V probably damaging Het
Eif4g3 T A 4: 138,163,433 probably null Het
Enpep C T 3: 129,309,099 D403N probably damaging Het
Entpd8 A G 2: 25,084,334 D377G probably benign Het
Epc2 T A 2: 49,547,607 probably null Het
Erich3 G T 3: 154,733,573 G481V probably damaging Het
Fank1 A G 7: 133,869,346 Y156C probably damaging Het
Fras1 A G 5: 96,781,344 D3869G probably damaging Het
Gcnt2 A G 13: 40,918,199 D106G probably benign Het
Gm20830 A T Y: 6,916,501 V206E probably benign Het
Gmpr2 T C 14: 55,677,234 V228A possibly damaging Het
Gon4l TGAGCA TGAGCAGAGCA 3: 88,896,216 probably null Het
Gtpbp1 G A 15: 79,712,174 probably null Het
Hhat A T 1: 192,717,019 M271K probably damaging Het
Hipk2 A T 6: 38,818,875 M153K possibly damaging Het
Hydin A T 8: 110,535,283 H2672L probably benign Het
Igfbpl1 A T 4: 45,826,374 D140E probably damaging Het
Kctd1 T G 18: 15,063,516 probably benign Het
Lax1 A T 1: 133,680,578 Y142N probably damaging Het
Lpin2 C T 17: 71,244,803 R733C probably damaging Het
Morn4 A G 19: 42,076,117 L144P possibly damaging Het
Nup214 C A 2: 32,034,373 T1638K probably damaging Het
Nyap1 C T 5: 137,734,984 A596T probably damaging Het
Oas1d T C 5: 120,915,011 M43T probably benign Het
Olfr724 T C 14: 49,960,623 T150A probably benign Het
Olfr901 A G 9: 38,431,176 H298R probably benign Het
Olfr986 T C 9: 40,187,601 V162A probably benign Het
Pacs1 A G 19: 5,136,791 F851S probably damaging Het
Pcdh17 A G 14: 84,446,360 Q89R probably damaging Het
Phrf1 A G 7: 141,258,465 probably benign Het
Plekhb1 A T 7: 100,655,395 I34N probably damaging Het
Ralgapa2 T C 2: 146,333,477 E1800G probably damaging Het
Rbm33 A T 5: 28,339,012 I89F probably damaging Het
Rtl1 T A 12: 109,594,097 E436V probably damaging Het
Slc2a4 G T 11: 69,946,391 P73Q probably damaging Het
Sorbs2 A T 8: 45,792,875 T311S probably benign Het
Sulf2 G A 2: 166,132,758 A2V probably benign Het
Supt16 A T 14: 52,174,144 probably null Het
Vmn1r26 A T 6: 58,008,753 N150K probably damaging Het
Vmn2r39 T A 7: 9,025,151 H407L possibly damaging Het
Vmn2r84 T A 10: 130,389,195 Y482F probably benign Het
Vps9d1 T C 8: 123,246,916 E376G probably benign Het
Wrn C A 8: 33,324,318 G366V probably benign Het
Other mutations in Enpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Enpp1 APN 10 24645427 missense possibly damaging 0.93
IGL00966:Enpp1 APN 10 24654031 missense probably damaging 1.00
IGL01364:Enpp1 APN 10 24664614 missense probably damaging 1.00
IGL02040:Enpp1 APN 10 24655856 missense probably damaging 1.00
IGL02143:Enpp1 APN 10 24677974 missense probably damaging 1.00
IGL02631:Enpp1 APN 10 24641961 missense probably damaging 1.00
IGL02655:Enpp1 APN 10 24677974 missense probably damaging 1.00
IGL02677:Enpp1 APN 10 24679185 splice site probably benign
IGL02691:Enpp1 APN 10 24711892 missense probably damaging 0.99
IGL02966:Enpp1 APN 10 24660274 missense probably damaging 1.00
IGL03087:Enpp1 APN 10 24655881 splice site probably benign
IGL03330:Enpp1 APN 10 24664906 splice site probably benign
IGL03365:Enpp1 APN 10 24669025 missense probably damaging 1.00
IGL03377:Enpp1 APN 10 24660283 critical splice acceptor site probably null
PIT4651001:Enpp1 UTSW 10 24653950 missense probably benign 0.16
R0011:Enpp1 UTSW 10 24670002 nonsense probably null
R0201:Enpp1 UTSW 10 24653917 missense probably benign 0.00
R0496:Enpp1 UTSW 10 24672052 missense probably benign 0.18
R1228:Enpp1 UTSW 10 24645412 missense probably benign 0.30
R1536:Enpp1 UTSW 10 24641834 missense probably benign 0.27
R1927:Enpp1 UTSW 10 24654888 missense possibly damaging 0.65
R2051:Enpp1 UTSW 10 24711804 critical splice donor site probably null
R2057:Enpp1 UTSW 10 24660192 missense probably damaging 0.98
R2353:Enpp1 UTSW 10 24651341 missense probably benign 0.24
R4077:Enpp1 UTSW 10 24669007 critical splice donor site probably null
R4079:Enpp1 UTSW 10 24669007 critical splice donor site probably null
R4739:Enpp1 UTSW 10 24679248 missense probably null 0.99
R4740:Enpp1 UTSW 10 24679248 missense probably null 0.99
R4761:Enpp1 UTSW 10 24641951 missense possibly damaging 0.94
R4822:Enpp1 UTSW 10 24661935 missense possibly damaging 0.74
R4919:Enpp1 UTSW 10 24648085 missense probably benign 0.01
R5140:Enpp1 UTSW 10 24652852 missense possibly damaging 0.51
R5302:Enpp1 UTSW 10 24651390 missense probably benign
R5421:Enpp1 UTSW 10 24669757 missense probably damaging 1.00
R5735:Enpp1 UTSW 10 24654919 missense possibly damaging 0.92
R5789:Enpp1 UTSW 10 24647239 missense probably benign
R5942:Enpp1 UTSW 10 24676068 nonsense probably null
R6048:Enpp1 UTSW 10 24660254 missense probably damaging 1.00
R6053:Enpp1 UTSW 10 24657126 missense possibly damaging 0.93
R6305:Enpp1 UTSW 10 24641882 missense probably damaging 1.00
R6319:Enpp1 UTSW 10 24648031 missense probably damaging 1.00
R6624:Enpp1 UTSW 10 24669755 nonsense probably null
R6793:Enpp1 UTSW 10 24655825 missense probably damaging 1.00
R6936:Enpp1 UTSW 10 24651339 missense probably benign 0.30
R7255:Enpp1 UTSW 10 24645315 missense possibly damaging 0.95
R7285:Enpp1 UTSW 10 24660161 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATCATATGTATGTGTGGGTCTACG -3'
(R):5'- CACTATACATAGGTGTGCATGTG -3'

Sequencing Primer
(F):5'- CACATGAGTGCTGGTGACAAC -3'
(R):5'- TGTACATATGTGTGCAATGCAG -3'
Posted On2016-11-09