Incidental Mutation 'R5695:Slc2a4'
ID443892
Institutional Source Beutler Lab
Gene Symbol Slc2a4
Ensembl Gene ENSMUSG00000018566
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 4
SynonymsGlut-4, Glut4
MMRRC Submission 043326-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R5695 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69942539-69948188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 69946391 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 73 (P73Q)
Ref Sequence ENSEMBL: ENSMUSP00000136806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018698] [ENSMUST00000018710] [ENSMUST00000108601] [ENSMUST00000135437] [ENSMUST00000141837] [ENSMUST00000142500] [ENSMUST00000149194] [ENSMUST00000178363] [ENSMUST00000179298]
Predicted Effect probably benign
Transcript: ENSMUST00000018698
SMART Domains Protein: ENSMUSP00000018698
Gene: ENSMUSG00000018554

DomainStartEndE-ValueType
low complexity region 2 68 N/A INTRINSIC
low complexity region 71 82 N/A INTRINSIC
CSP 96 164 2.54e-21 SMART
low complexity region 173 212 N/A INTRINSIC
low complexity region 220 242 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
low complexity region 317 339 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000018710
AA Change: P73Q

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000018710
Gene: ENSMUSG00000018566
AA Change: P73Q

DomainStartEndE-ValueType
Pfam:MFS_1 24 436 3.9e-16 PFAM
Pfam:Sugar_tr 27 483 1.7e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108601
SMART Domains Protein: ENSMUSP00000104242
Gene: ENSMUSG00000018554

DomainStartEndE-ValueType
CSP 19 87 2.54e-21 SMART
low complexity region 96 135 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 197 217 N/A INTRINSIC
low complexity region 240 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118013
Predicted Effect probably benign
Transcript: ENSMUST00000135437
SMART Domains Protein: ENSMUSP00000137092
Gene: ENSMUSG00000018566

DomainStartEndE-ValueType
Pfam:Sugar_tr 1 57 5.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141837
AA Change: P73Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136806
Gene: ENSMUSG00000018566
AA Change: P73Q

DomainStartEndE-ValueType
Pfam:MFS_1 24 438 4.7e-17 PFAM
Pfam:Sugar_tr 26 453 6e-140 PFAM
low complexity region 462 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148395
Predicted Effect probably benign
Transcript: ENSMUST00000149194
SMART Domains Protein: ENSMUSP00000136684
Gene: ENSMUSG00000018554

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 25 47 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 122 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152487
Predicted Effect probably benign
Transcript: ENSMUST00000178363
SMART Domains Protein: ENSMUSP00000136455
Gene: ENSMUSG00000018566

DomainStartEndE-ValueType
PDB:4PYP|A 14 50 3e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178809
Predicted Effect probably benign
Transcript: ENSMUST00000179298
AA Change: P73Q

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000136726
Gene: ENSMUSG00000018566
AA Change: P73Q

DomainStartEndE-ValueType
Pfam:Sugar_tr 26 242 6.9e-65 PFAM
Pfam:MFS_1 27 239 2e-10 PFAM
Meta Mutation Damage Score 0.0264 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the solute carrier family 2 (facilitated glucose transporter) family and encodes a protein that functions as an insulin-regulated facilitative glucose transporter. In the absence of insulin, this integral membrane protein is sequestered within the cells of muscle and adipose tissue. Within minutes of insulin stimulation, the protein moves to the cell surface and begins to transport glucose across the cell membrane. Mutations in this gene have been associated with noninsulin-dependent diabetes mellitus (NIDDM). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes impaired glucose metabolism in skeletal muscle and adipose tissue. Mice homozygous for a knock-out allele show premature death associated with cardiac hypertrophy, growth retardation, insulin resistance, reduced adipose tissue deposits, and muscle fatigue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,613,971 H116L probably damaging Het
Anapc4 C T 5: 52,862,239 S581L probably benign Het
Ano8 A C 8: 71,483,243 D276E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Bpifb4 G A 2: 153,942,923 G184S probably damaging Het
Cbx8 T C 11: 119,039,311 D152G probably benign Het
Cdca2 A G 14: 67,705,629 probably null Het
Cgn G A 3: 94,773,635 A531V probably benign Het
Cmya5 C A 13: 93,045,866 probably null Het
Cntnap3 A G 13: 64,787,955 S365P probably damaging Het
Crnn A G 3: 93,149,023 Q372R probably damaging Het
Ehf T A 2: 103,266,779 E276V probably damaging Het
Eif4g3 T A 4: 138,163,433 probably null Het
Enpep C T 3: 129,309,099 D403N probably damaging Het
Enpp1 T C 10: 24,654,908 E550G probably damaging Het
Entpd8 A G 2: 25,084,334 D377G probably benign Het
Epc2 T A 2: 49,547,607 probably null Het
Erich3 G T 3: 154,733,573 G481V probably damaging Het
Fank1 A G 7: 133,869,346 Y156C probably damaging Het
Fras1 A G 5: 96,781,344 D3869G probably damaging Het
Gcnt2 A G 13: 40,918,199 D106G probably benign Het
Gm20830 A T Y: 6,916,501 V206E probably benign Het
Gmpr2 T C 14: 55,677,234 V228A possibly damaging Het
Gon4l TGAGCA TGAGCAGAGCA 3: 88,896,216 probably null Het
Gtpbp1 G A 15: 79,712,174 probably null Het
Hhat A T 1: 192,717,019 M271K probably damaging Het
Hipk2 A T 6: 38,818,875 M153K possibly damaging Het
Hydin A T 8: 110,535,283 H2672L probably benign Het
Igfbpl1 A T 4: 45,826,374 D140E probably damaging Het
Kctd1 T G 18: 15,063,516 probably benign Het
Lax1 A T 1: 133,680,578 Y142N probably damaging Het
Lpin2 C T 17: 71,244,803 R733C probably damaging Het
Morn4 A G 19: 42,076,117 L144P possibly damaging Het
Nup214 C A 2: 32,034,373 T1638K probably damaging Het
Nyap1 C T 5: 137,734,984 A596T probably damaging Het
Oas1d T C 5: 120,915,011 M43T probably benign Het
Olfr724 T C 14: 49,960,623 T150A probably benign Het
Olfr901 A G 9: 38,431,176 H298R probably benign Het
Olfr986 T C 9: 40,187,601 V162A probably benign Het
Pacs1 A G 19: 5,136,791 F851S probably damaging Het
Pcdh17 A G 14: 84,446,360 Q89R probably damaging Het
Phrf1 A G 7: 141,258,465 probably benign Het
Plekhb1 A T 7: 100,655,395 I34N probably damaging Het
Ralgapa2 T C 2: 146,333,477 E1800G probably damaging Het
Rbm33 A T 5: 28,339,012 I89F probably damaging Het
Rtl1 T A 12: 109,594,097 E436V probably damaging Het
Sorbs2 A T 8: 45,792,875 T311S probably benign Het
Sulf2 G A 2: 166,132,758 A2V probably benign Het
Supt16 A T 14: 52,174,144 probably null Het
Vmn1r26 A T 6: 58,008,753 N150K probably damaging Het
Vmn2r39 T A 7: 9,025,151 H407L possibly damaging Het
Vmn2r84 T A 10: 130,389,195 Y482F probably benign Het
Vps9d1 T C 8: 123,246,916 E376G probably benign Het
Wrn C A 8: 33,324,318 G366V probably benign Het
Other mutations in Slc2a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Slc2a4 APN 11 69945956 splice site probably benign
IGL01448:Slc2a4 APN 11 69945076 missense possibly damaging 0.80
IGL01593:Slc2a4 APN 11 69944828 missense probably damaging 0.98
IGL02188:Slc2a4 APN 11 69946330 start codon destroyed probably null 0.00
IGL02738:Slc2a4 APN 11 69946114 missense probably damaging 1.00
R0282:Slc2a4 UTSW 11 69946355 missense probably damaging 1.00
R0317:Slc2a4 UTSW 11 69946356 missense probably damaging 1.00
R0709:Slc2a4 UTSW 11 69946159 missense possibly damaging 0.92
R1598:Slc2a4 UTSW 11 69945018 missense probably benign 0.00
R1800:Slc2a4 UTSW 11 69946307 missense probably benign 0.08
R1885:Slc2a4 UTSW 11 69945007 missense probably benign 0.03
R1893:Slc2a4 UTSW 11 69946572 missense probably damaging 1.00
R2439:Slc2a4 UTSW 11 69945625 missense possibly damaging 0.93
R2847:Slc2a4 UTSW 11 69946171 missense probably damaging 1.00
R2849:Slc2a4 UTSW 11 69946171 missense probably damaging 1.00
R2865:Slc2a4 UTSW 11 69946116 missense probably damaging 1.00
R3001:Slc2a4 UTSW 11 69945925 nonsense probably null
R3002:Slc2a4 UTSW 11 69945925 nonsense probably null
R4455:Slc2a4 UTSW 11 69943322 unclassified probably benign
R4456:Slc2a4 UTSW 11 69943322 unclassified probably benign
R4463:Slc2a4 UTSW 11 69943322 unclassified probably benign
R4622:Slc2a4 UTSW 11 69944774 unclassified probably benign
R4822:Slc2a4 UTSW 11 69946587 missense probably damaging 1.00
R6348:Slc2a4 UTSW 11 69945022 missense probably benign 0.03
R7294:Slc2a4 UTSW 11 69945399 missense probably benign 0.00
R7315:Slc2a4 UTSW 11 69946433 missense probably damaging 0.99
X0067:Slc2a4 UTSW 11 69944256 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TTTTCCTGGCAGGCACACAG -3'
(R):5'- GGGTTATCAATGCCCCACAGAAG -3'

Sequencing Primer
(F):5'- GAGGAGGGCTGGTCACGAC -3'
(R):5'- GGTGAGTGACCTACCAGCTG -3'
Posted On2016-11-09