Incidental Mutation 'R5695:Cmya5'
ID443898
Institutional Source Beutler Lab
Gene Symbol Cmya5
Ensembl Gene ENSMUSG00000047419
Gene Namecardiomyopathy associated 5
SynonymsMyospryn, 2310076E21Rik, 2310076E16Rik
MMRRC Submission 043326-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R5695 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location93040713-93144724 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 93045866 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000050408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062122]
Predicted Effect probably null
Transcript: ENSMUST00000062122
SMART Domains Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
internal_repeat_1 448 535 5.09e-18 PROSPERO
internal_repeat_1 543 625 5.09e-18 PROSPERO
low complexity region 626 645 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 734 741 N/A INTRINSIC
low complexity region 1001 1010 N/A INTRINSIC
low complexity region 1166 1183 N/A INTRINSIC
low complexity region 1259 1267 N/A INTRINSIC
low complexity region 1440 1449 N/A INTRINSIC
low complexity region 1876 1889 N/A INTRINSIC
low complexity region 2632 2645 N/A INTRINSIC
low complexity region 3048 3057 N/A INTRINSIC
FN3 3312 3399 7.29e-4 SMART
FN3 3411 3492 1.3e0 SMART
Pfam:SPRY 3551 3668 6.7e-8 PFAM
Meta Mutation Damage Score 0.528 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,613,971 H116L probably damaging Het
Anapc4 C T 5: 52,862,239 S581L probably benign Het
Ano8 A C 8: 71,483,243 D276E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Bpifb4 G A 2: 153,942,923 G184S probably damaging Het
Cbx8 T C 11: 119,039,311 D152G probably benign Het
Cdca2 A G 14: 67,705,629 probably null Het
Cgn G A 3: 94,773,635 A531V probably benign Het
Cntnap3 A G 13: 64,787,955 S365P probably damaging Het
Crnn A G 3: 93,149,023 Q372R probably damaging Het
Ehf T A 2: 103,266,779 E276V probably damaging Het
Eif4g3 T A 4: 138,163,433 probably null Het
Enpep C T 3: 129,309,099 D403N probably damaging Het
Enpp1 T C 10: 24,654,908 E550G probably damaging Het
Entpd8 A G 2: 25,084,334 D377G probably benign Het
Epc2 T A 2: 49,547,607 probably null Het
Erich3 G T 3: 154,733,573 G481V probably damaging Het
Fank1 A G 7: 133,869,346 Y156C probably damaging Het
Fras1 A G 5: 96,781,344 D3869G probably damaging Het
Gcnt2 A G 13: 40,918,199 D106G probably benign Het
Gm20830 A T Y: 6,916,501 V206E probably benign Het
Gmpr2 T C 14: 55,677,234 V228A possibly damaging Het
Gon4l TGAGCA TGAGCAGAGCA 3: 88,896,216 probably null Het
Gtpbp1 G A 15: 79,712,174 probably null Het
Hhat A T 1: 192,717,019 M271K probably damaging Het
Hipk2 A T 6: 38,818,875 M153K possibly damaging Het
Hydin A T 8: 110,535,283 H2672L probably benign Het
Igfbpl1 A T 4: 45,826,374 D140E probably damaging Het
Kctd1 T G 18: 15,063,516 probably benign Het
Lax1 A T 1: 133,680,578 Y142N probably damaging Het
Lpin2 C T 17: 71,244,803 R733C probably damaging Het
Morn4 A G 19: 42,076,117 L144P possibly damaging Het
Nup214 C A 2: 32,034,373 T1638K probably damaging Het
Nyap1 C T 5: 137,734,984 A596T probably damaging Het
Oas1d T C 5: 120,915,011 M43T probably benign Het
Olfr724 T C 14: 49,960,623 T150A probably benign Het
Olfr901 A G 9: 38,431,176 H298R probably benign Het
Olfr986 T C 9: 40,187,601 V162A probably benign Het
Pacs1 A G 19: 5,136,791 F851S probably damaging Het
Pcdh17 A G 14: 84,446,360 Q89R probably damaging Het
Phrf1 A G 7: 141,258,465 probably benign Het
Plekhb1 A T 7: 100,655,395 I34N probably damaging Het
Ralgapa2 T C 2: 146,333,477 E1800G probably damaging Het
Rbm33 A T 5: 28,339,012 I89F probably damaging Het
Rtl1 T A 12: 109,594,097 E436V probably damaging Het
Slc2a4 G T 11: 69,946,391 P73Q probably damaging Het
Sorbs2 A T 8: 45,792,875 T311S probably benign Het
Sulf2 G A 2: 166,132,758 A2V probably benign Het
Supt16 A T 14: 52,174,144 probably null Het
Vmn1r26 A T 6: 58,008,753 N150K probably damaging Het
Vmn2r39 T A 7: 9,025,151 H407L possibly damaging Het
Vmn2r84 T A 10: 130,389,195 Y482F probably benign Het
Vps9d1 T C 8: 123,246,916 E376G probably benign Het
Wrn C A 8: 33,324,318 G366V probably benign Het
Other mutations in Cmya5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Cmya5 APN 13 93093120 missense probably benign 0.13
IGL00516:Cmya5 APN 13 93098167 missense possibly damaging 0.73
IGL00654:Cmya5 APN 13 93094161 missense probably benign 0.00
IGL00948:Cmya5 APN 13 93091036 missense probably benign
IGL00966:Cmya5 APN 13 93097906 missense probably benign 0.33
IGL00988:Cmya5 APN 13 93097933 missense possibly damaging 0.96
IGL01106:Cmya5 APN 13 93084612 missense probably damaging 1.00
IGL01331:Cmya5 APN 13 93096946 missense possibly damaging 0.53
IGL01392:Cmya5 APN 13 93089206 missense probably damaging 0.99
IGL01508:Cmya5 APN 13 93094027 missense probably benign
IGL01679:Cmya5 APN 13 93065320 missense probably damaging 1.00
IGL01749:Cmya5 APN 13 93089299 missense probably benign 0.00
IGL01861:Cmya5 APN 13 93089748 missense probably damaging 1.00
IGL02021:Cmya5 APN 13 93094549 missense probably benign 0.00
IGL02034:Cmya5 APN 13 93084535 splice site probably benign
IGL02103:Cmya5 APN 13 93092127 missense probably benign 0.05
IGL02174:Cmya5 APN 13 93048907 missense possibly damaging 0.76
IGL02176:Cmya5 APN 13 93090150 missense probably damaging 1.00
IGL02210:Cmya5 APN 13 93092734 missense probably benign 0.14
IGL02229:Cmya5 APN 13 93092686 missense possibly damaging 0.54
IGL02306:Cmya5 APN 13 93098019 missense probably damaging 1.00
IGL02311:Cmya5 APN 13 93090655 missense probably benign 0.40
IGL02409:Cmya5 APN 13 93090198 missense probably damaging 0.96
IGL02561:Cmya5 APN 13 93091858 missense probably benign 0.00
IGL02676:Cmya5 APN 13 93092853 missense probably damaging 1.00
IGL02683:Cmya5 APN 13 93090997 nonsense probably null
IGL02685:Cmya5 APN 13 93090997 nonsense probably null
IGL02686:Cmya5 APN 13 93090997 nonsense probably null
IGL02724:Cmya5 APN 13 93096655 missense probably benign
IGL02727:Cmya5 APN 13 93098245 missense possibly damaging 0.73
IGL02965:Cmya5 APN 13 93092557 missense probably benign 0.41
IGL03079:Cmya5 APN 13 93097701 missense possibly damaging 0.85
IGL03144:Cmya5 APN 13 93090868 missense probably damaging 1.00
IGL03253:Cmya5 APN 13 93091270 nonsense probably null
IGL03336:Cmya5 APN 13 93093505 missense possibly damaging 0.84
IGL03138:Cmya5 UTSW 13 93065342 missense probably damaging 1.00
P0023:Cmya5 UTSW 13 93089346 missense probably benign 0.22
P4748:Cmya5 UTSW 13 93074475 splice site probably benign
R0123:Cmya5 UTSW 13 93095904 missense possibly damaging 0.84
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0331:Cmya5 UTSW 13 93144403 missense possibly damaging 0.53
R0363:Cmya5 UTSW 13 93094869 missense possibly damaging 0.77
R0382:Cmya5 UTSW 13 93092748 missense probably benign 0.06
R0416:Cmya5 UTSW 13 93089856 missense probably benign 0.05
R0446:Cmya5 UTSW 13 93093656 missense probably benign
R0457:Cmya5 UTSW 13 93095587 missense possibly damaging 0.84
R0673:Cmya5 UTSW 13 93089997 missense probably damaging 1.00
R0674:Cmya5 UTSW 13 93092791 missense probably damaging 1.00
R0692:Cmya5 UTSW 13 93093849 nonsense probably null
R0698:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R1227:Cmya5 UTSW 13 93094446 missense probably damaging 0.99
R1272:Cmya5 UTSW 13 93095112 missense possibly damaging 0.79
R1335:Cmya5 UTSW 13 93041535 missense possibly damaging 0.65
R1353:Cmya5 UTSW 13 93041525 missense probably damaging 1.00
R1354:Cmya5 UTSW 13 93092058 missense possibly damaging 0.46
R1458:Cmya5 UTSW 13 93065327 missense probably benign 0.44
R1572:Cmya5 UTSW 13 93094269 missense possibly damaging 0.61
R1698:Cmya5 UTSW 13 93063519 missense probably benign 0.27
R1735:Cmya5 UTSW 13 93089789 missense probably benign 0.11
R1743:Cmya5 UTSW 13 93097317 missense probably benign 0.33
R1750:Cmya5 UTSW 13 93095663 missense probably benign
R1827:Cmya5 UTSW 13 93074448 missense possibly damaging 0.80
R2068:Cmya5 UTSW 13 93090524 missense possibly damaging 0.93
R2088:Cmya5 UTSW 13 93092812 missense probably damaging 1.00
R2132:Cmya5 UTSW 13 93069383 missense probably damaging 1.00
R2216:Cmya5 UTSW 13 93093495 missense probably damaging 1.00
R2363:Cmya5 UTSW 13 93093702 missense probably benign 0.15
R2497:Cmya5 UTSW 13 93098005 missense possibly damaging 0.53
R2509:Cmya5 UTSW 13 93093558 missense probably benign 0.41
R2917:Cmya5 UTSW 13 93091064 nonsense probably null
R2944:Cmya5 UTSW 13 93092842 nonsense probably null
R3039:Cmya5 UTSW 13 93092250 missense probably benign 0.12
R3078:Cmya5 UTSW 13 93048927 missense probably damaging 0.99
R3708:Cmya5 UTSW 13 93095366 nonsense probably null
R3717:Cmya5 UTSW 13 93092487 missense probably benign 0.12
R3768:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3769:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3840:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3841:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3882:Cmya5 UTSW 13 93091219 missense probably benign 0.07
R3888:Cmya5 UTSW 13 93093656 missense probably benign
R3897:Cmya5 UTSW 13 93096681 missense possibly damaging 0.72
R3952:Cmya5 UTSW 13 93089199 missense possibly damaging 0.89
R4366:Cmya5 UTSW 13 93091956 missense probably benign 0.36
R4471:Cmya5 UTSW 13 93092325 missense probably benign 0.01
R4493:Cmya5 UTSW 13 93094065 missense probably benign
R4495:Cmya5 UTSW 13 93094065 missense probably benign
R4544:Cmya5 UTSW 13 93091918 nonsense probably null
R4545:Cmya5 UTSW 13 93091918 nonsense probably null
R4624:Cmya5 UTSW 13 93063551 missense probably damaging 1.00
R4648:Cmya5 UTSW 13 93093828 missense possibly damaging 0.84
R4824:Cmya5 UTSW 13 93093574 missense probably benign 0.04
R4965:Cmya5 UTSW 13 93095787 missense possibly damaging 0.84
R4967:Cmya5 UTSW 13 93090585 missense probably damaging 1.00
R5101:Cmya5 UTSW 13 93091603 missense possibly damaging 0.61
R5133:Cmya5 UTSW 13 93093372 missense possibly damaging 0.79
R5139:Cmya5 UTSW 13 93096061 missense probably benign 0.00
R5220:Cmya5 UTSW 13 93092296 missense probably damaging 0.99
R5332:Cmya5 UTSW 13 93096195 missense probably damaging 0.96
R5337:Cmya5 UTSW 13 93083273 missense probably benign 0.28
R5356:Cmya5 UTSW 13 93063485 missense probably damaging 1.00
R5401:Cmya5 UTSW 13 93091968 missense probably damaging 1.00
R5438:Cmya5 UTSW 13 93095199 missense possibly damaging 0.89
R5604:Cmya5 UTSW 13 93092763 missense probably benign 0.15
R5628:Cmya5 UTSW 13 93089710 missense probably damaging 1.00
R5666:Cmya5 UTSW 13 93045949 missense possibly damaging 0.75
R5687:Cmya5 UTSW 13 93098176 missense possibly damaging 0.53
R5806:Cmya5 UTSW 13 93093937 missense possibly damaging 0.84
R5820:Cmya5 UTSW 13 93092780 missense probably benign 0.04
R5872:Cmya5 UTSW 13 93097435 missense probably benign 0.01
R5875:Cmya5 UTSW 13 93095184 missense probably benign 0.13
R5896:Cmya5 UTSW 13 93045865 critical splice donor site probably null
R5910:Cmya5 UTSW 13 93092643 missense probably damaging 0.98
R5969:Cmya5 UTSW 13 93089544 missense possibly damaging 0.78
R6064:Cmya5 UTSW 13 93089649 missense probably damaging 1.00
R6081:Cmya5 UTSW 13 93144513 unclassified probably benign
R6102:Cmya5 UTSW 13 93094231 missense probably benign
R6117:Cmya5 UTSW 13 93095166 missense probably damaging 0.98
R6188:Cmya5 UTSW 13 93093444 missense possibly damaging 0.61
R6188:Cmya5 UTSW 13 93097276 missense possibly damaging 0.73
R6219:Cmya5 UTSW 13 93094443 missense probably damaging 1.00
R6229:Cmya5 UTSW 13 93093306 missense probably benign 0.41
R6346:Cmya5 UTSW 13 93092190 missense probably damaging 1.00
R6431:Cmya5 UTSW 13 93074464 missense possibly damaging 0.60
R6436:Cmya5 UTSW 13 93089215 missense probably damaging 0.98
R6598:Cmya5 UTSW 13 93089808 missense probably benign 0.05
R6649:Cmya5 UTSW 13 93098025 missense possibly damaging 0.91
R6652:Cmya5 UTSW 13 93092895 missense probably benign 0.04
R6652:Cmya5 UTSW 13 93093039 missense probably damaging 0.99
R6669:Cmya5 UTSW 13 93093259 missense probably benign 0.03
R6881:Cmya5 UTSW 13 93090292 missense probably damaging 1.00
R6909:Cmya5 UTSW 13 93091252 missense probably benign 0.04
R6933:Cmya5 UTSW 13 93095136 missense probably benign 0.03
R7021:Cmya5 UTSW 13 93093555 missense possibly damaging 0.62
R7022:Cmya5 UTSW 13 93069278 critical splice donor site probably null
R7068:Cmya5 UTSW 13 93092697 missense possibly damaging 0.59
R7087:Cmya5 UTSW 13 93090975 missense not run
R7088:Cmya5 UTSW 13 93091864 missense not run
R7126:Cmya5 UTSW 13 93089940 missense not run
X0028:Cmya5 UTSW 13 93096687 missense possibly damaging 0.53
Z1088:Cmya5 UTSW 13 93063579 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGGTTGAATATACGGCATCCTC -3'
(R):5'- TGGTCAACTCTGCTTGCAGG -3'

Sequencing Primer
(F):5'- GGTTGAATATACGGCATCCTCTTATC -3'
(R):5'- TTGCAGGATCCCCTCAGTG -3'
Posted On2016-11-09