Incidental Mutation 'R5695:Olfr724'
ID443899
Institutional Source Beutler Lab
Gene Symbol Olfr724
Ensembl Gene ENSMUSG00000096254
Gene Nameolfactory receptor 724
SynonymsGA_x6K02T2PMLR-5645801-5644872, MOR247-2
MMRRC Submission 043326-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R5695 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location49960023-49963274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49960623 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 150 (T150A)
Ref Sequence ENSEMBL: ENSMUSP00000149110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075030] [ENSMUST00000213390]
Predicted Effect probably benign
Transcript: ENSMUST00000075030
AA Change: T150A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000074546
Gene: ENSMUSG00000096254
AA Change: T150A

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.3e-42 PFAM
Pfam:7TM_GPCR_Srsx 34 302 3e-11 PFAM
Pfam:7tm_1 41 287 5.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213390
AA Change: T150A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,613,971 H116L probably damaging Het
Anapc4 C T 5: 52,862,239 S581L probably benign Het
Ano8 A C 8: 71,483,243 D276E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Bpifb4 G A 2: 153,942,923 G184S probably damaging Het
Cbx8 T C 11: 119,039,311 D152G probably benign Het
Cdca2 A G 14: 67,705,629 probably null Het
Cgn G A 3: 94,773,635 A531V probably benign Het
Cmya5 C A 13: 93,045,866 probably null Het
Cntnap3 A G 13: 64,787,955 S365P probably damaging Het
Crnn A G 3: 93,149,023 Q372R probably damaging Het
Ehf T A 2: 103,266,779 E276V probably damaging Het
Eif4g3 T A 4: 138,163,433 probably null Het
Enpep C T 3: 129,309,099 D403N probably damaging Het
Enpp1 T C 10: 24,654,908 E550G probably damaging Het
Entpd8 A G 2: 25,084,334 D377G probably benign Het
Epc2 T A 2: 49,547,607 probably null Het
Erich3 G T 3: 154,733,573 G481V probably damaging Het
Fank1 A G 7: 133,869,346 Y156C probably damaging Het
Fras1 A G 5: 96,781,344 D3869G probably damaging Het
Gcnt2 A G 13: 40,918,199 D106G probably benign Het
Gm20830 A T Y: 6,916,501 V206E probably benign Het
Gmpr2 T C 14: 55,677,234 V228A possibly damaging Het
Gon4l TGAGCA TGAGCAGAGCA 3: 88,896,216 probably null Het
Gtpbp1 G A 15: 79,712,174 probably null Het
Hhat A T 1: 192,717,019 M271K probably damaging Het
Hipk2 A T 6: 38,818,875 M153K possibly damaging Het
Hydin A T 8: 110,535,283 H2672L probably benign Het
Igfbpl1 A T 4: 45,826,374 D140E probably damaging Het
Kctd1 T G 18: 15,063,516 probably benign Het
Lax1 A T 1: 133,680,578 Y142N probably damaging Het
Lpin2 C T 17: 71,244,803 R733C probably damaging Het
Morn4 A G 19: 42,076,117 L144P possibly damaging Het
Nup214 C A 2: 32,034,373 T1638K probably damaging Het
Nyap1 C T 5: 137,734,984 A596T probably damaging Het
Oas1d T C 5: 120,915,011 M43T probably benign Het
Olfr901 A G 9: 38,431,176 H298R probably benign Het
Olfr986 T C 9: 40,187,601 V162A probably benign Het
Pacs1 A G 19: 5,136,791 F851S probably damaging Het
Pcdh17 A G 14: 84,446,360 Q89R probably damaging Het
Phrf1 A G 7: 141,258,465 probably benign Het
Plekhb1 A T 7: 100,655,395 I34N probably damaging Het
Ralgapa2 T C 2: 146,333,477 E1800G probably damaging Het
Rbm33 A T 5: 28,339,012 I89F probably damaging Het
Rtl1 T A 12: 109,594,097 E436V probably damaging Het
Slc2a4 G T 11: 69,946,391 P73Q probably damaging Het
Sorbs2 A T 8: 45,792,875 T311S probably benign Het
Sulf2 G A 2: 166,132,758 A2V probably benign Het
Supt16 A T 14: 52,174,144 probably null Het
Vmn1r26 A T 6: 58,008,753 N150K probably damaging Het
Vmn2r39 T A 7: 9,025,151 H407L possibly damaging Het
Vmn2r84 T A 10: 130,389,195 Y482F probably benign Het
Vps9d1 T C 8: 123,246,916 E376G probably benign Het
Wrn C A 8: 33,324,318 G366V probably benign Het
Other mutations in Olfr724
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02811:Olfr724 APN 14 49960133 utr 3 prime probably benign
R0829:Olfr724 UTSW 14 49961046 missense probably benign 0.03
R1513:Olfr724 UTSW 14 49961101 critical splice acceptor site probably null
R2016:Olfr724 UTSW 14 49960502 missense probably benign 0.00
R2936:Olfr724 UTSW 14 49960154 missense probably benign 0.03
R3082:Olfr724 UTSW 14 49960704 missense probably damaging 1.00
R3738:Olfr724 UTSW 14 49960556 missense possibly damaging 0.60
R4772:Olfr724 UTSW 14 49960995 small deletion probably benign
R4830:Olfr724 UTSW 14 49960224 missense probably damaging 1.00
R4839:Olfr724 UTSW 14 49960189 missense probably benign 0.41
R5362:Olfr724 UTSW 14 49960529 missense possibly damaging 0.95
R6187:Olfr724 UTSW 14 49961069 start codon destroyed probably null 0.99
Predicted Primers PCR Primer
(F):5'- AGACTGCCAGGTGATTTGTGC -3'
(R):5'- TTTTCAGGGCTGCATGGTCC -3'

Sequencing Primer
(F):5'- TGCTTTACAATGAGCAGAATGACAG -3'
(R):5'- GCATGGTCCAGATGTTCTTCAGC -3'
Posted On2016-11-09