Incidental Mutation 'R5695:Gmpr2'
ID443901
Institutional Source Beutler Lab
Gene Symbol Gmpr2
Ensembl Gene ENSMUSG00000002326
Gene Nameguanosine monophosphate reductase 2
Synonyms
MMRRC Submission 043326-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.354) question?
Stock #R5695 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55671941-55679200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55677234 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 228 (V228A)
Ref Sequence ENSEMBL: ENSMUSP00000002397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002397] [ENSMUST00000007733] [ENSMUST00000226314] [ENSMUST00000227178] [ENSMUST00000227842] [ENSMUST00000227873] [ENSMUST00000227914]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002397
AA Change: V228A

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000002397
Gene: ENSMUSG00000002326
AA Change: V228A

DomainStartEndE-ValueType
IMPDH 8 347 7.5e-147 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000007733
SMART Domains Protein: ENSMUSP00000007733
Gene: ENSMUSG00000007589

DomainStartEndE-ValueType
Pfam:TINF2_N 20 159 1.8e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226787
Predicted Effect probably benign
Transcript: ENSMUST00000226819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227106
Predicted Effect probably benign
Transcript: ENSMUST00000227178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227696
Predicted Effect silent
Transcript: ENSMUST00000227842
Predicted Effect probably benign
Transcript: ENSMUST00000227873
Predicted Effect probably benign
Transcript: ENSMUST00000227914
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228683
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,613,971 H116L probably damaging Het
Anapc4 C T 5: 52,862,239 S581L probably benign Het
Ano8 A C 8: 71,483,243 D276E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Bpifb4 G A 2: 153,942,923 G184S probably damaging Het
Cbx8 T C 11: 119,039,311 D152G probably benign Het
Cdca2 A G 14: 67,705,629 probably null Het
Cgn G A 3: 94,773,635 A531V probably benign Het
Cmya5 C A 13: 93,045,866 probably null Het
Cntnap3 A G 13: 64,787,955 S365P probably damaging Het
Crnn A G 3: 93,149,023 Q372R probably damaging Het
Ehf T A 2: 103,266,779 E276V probably damaging Het
Eif4g3 T A 4: 138,163,433 probably null Het
Enpep C T 3: 129,309,099 D403N probably damaging Het
Enpp1 T C 10: 24,654,908 E550G probably damaging Het
Entpd8 A G 2: 25,084,334 D377G probably benign Het
Epc2 T A 2: 49,547,607 probably null Het
Erich3 G T 3: 154,733,573 G481V probably damaging Het
Fank1 A G 7: 133,869,346 Y156C probably damaging Het
Fras1 A G 5: 96,781,344 D3869G probably damaging Het
Gcnt2 A G 13: 40,918,199 D106G probably benign Het
Gm20830 A T Y: 6,916,501 V206E probably benign Het
Gon4l TGAGCA TGAGCAGAGCA 3: 88,896,216 probably null Het
Gtpbp1 G A 15: 79,712,174 probably null Het
Hhat A T 1: 192,717,019 M271K probably damaging Het
Hipk2 A T 6: 38,818,875 M153K possibly damaging Het
Hydin A T 8: 110,535,283 H2672L probably benign Het
Igfbpl1 A T 4: 45,826,374 D140E probably damaging Het
Kctd1 T G 18: 15,063,516 probably benign Het
Lax1 A T 1: 133,680,578 Y142N probably damaging Het
Lpin2 C T 17: 71,244,803 R733C probably damaging Het
Morn4 A G 19: 42,076,117 L144P possibly damaging Het
Nup214 C A 2: 32,034,373 T1638K probably damaging Het
Nyap1 C T 5: 137,734,984 A596T probably damaging Het
Oas1d T C 5: 120,915,011 M43T probably benign Het
Olfr724 T C 14: 49,960,623 T150A probably benign Het
Olfr901 A G 9: 38,431,176 H298R probably benign Het
Olfr986 T C 9: 40,187,601 V162A probably benign Het
Pacs1 A G 19: 5,136,791 F851S probably damaging Het
Pcdh17 A G 14: 84,446,360 Q89R probably damaging Het
Phrf1 A G 7: 141,258,465 probably benign Het
Plekhb1 A T 7: 100,655,395 I34N probably damaging Het
Ralgapa2 T C 2: 146,333,477 E1800G probably damaging Het
Rbm33 A T 5: 28,339,012 I89F probably damaging Het
Rtl1 T A 12: 109,594,097 E436V probably damaging Het
Slc2a4 G T 11: 69,946,391 P73Q probably damaging Het
Sorbs2 A T 8: 45,792,875 T311S probably benign Het
Sulf2 G A 2: 166,132,758 A2V probably benign Het
Supt16 A T 14: 52,174,144 probably null Het
Vmn1r26 A T 6: 58,008,753 N150K probably damaging Het
Vmn2r39 T A 7: 9,025,151 H407L possibly damaging Het
Vmn2r84 T A 10: 130,389,195 Y482F probably benign Het
Vps9d1 T C 8: 123,246,916 E376G probably benign Het
Wrn C A 8: 33,324,318 G366V probably benign Het
Other mutations in Gmpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Gmpr2 APN 14 55675714 missense probably damaging 0.98
IGL00949:Gmpr2 APN 14 55676750 splice site probably benign
IGL02348:Gmpr2 APN 14 55678301 missense probably damaging 1.00
R0092:Gmpr2 UTSW 14 55677945 missense probably benign 0.36
R0197:Gmpr2 UTSW 14 55672735 missense possibly damaging 0.83
R0323:Gmpr2 UTSW 14 55672746 missense probably damaging 0.99
R0594:Gmpr2 UTSW 14 55677988 missense probably damaging 1.00
R1366:Gmpr2 UTSW 14 55676743 splice site probably benign
R2904:Gmpr2 UTSW 14 55672758 missense probably damaging 1.00
R4996:Gmpr2 UTSW 14 55676795 missense probably damaging 0.99
R5407:Gmpr2 UTSW 14 55678276 missense possibly damaging 0.72
R6721:Gmpr2 UTSW 14 55672734 missense probably damaging 1.00
X0025:Gmpr2 UTSW 14 55675390 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTGCTCATGGCCTCAAAG -3'
(R):5'- CCCAGGTGACACTTTAGGTTC -3'

Sequencing Primer
(F):5'- TCTCAGTAAGACTCAAGACCTGGAG -3'
(R):5'- CACTTTAGGTTCCTGAGGAGGTCAC -3'
Posted On2016-11-09