Incidental Mutation 'R5695:Pacs1'
ID443907
Institutional Source Beutler Lab
Gene Symbol Pacs1
Ensembl Gene ENSMUSG00000024855
Gene Namephosphofurin acidic cluster sorting protein 1
Synonyms
MMRRC Submission 043326-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5695 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5133688-5273119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5136791 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 851 (F851S)
Ref Sequence ENSEMBL: ENSMUSP00000025786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025786]
Predicted Effect probably damaging
Transcript: ENSMUST00000025786
AA Change: F851S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025786
Gene: ENSMUSG00000024855
AA Change: F851S

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 27 46 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Pacs-1 546 958 2e-193 PFAM
Meta Mutation Damage Score 0.338 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a putative role in the localization of trans-Golgi network (TGN) membrane proteins. Mouse and rat homologs have been identified and studies of the homologous rat protein indicate a role in directing TGN localization of furin by binding to the protease's phosphorylated cytosolic domain. In addition, the human protein plays a role in HIV-1 Nef-mediated downregulation of cell surface MHC-I molecules to the TGN, thereby enabling HIV-1 to escape immune surveillance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,613,971 H116L probably damaging Het
Anapc4 C T 5: 52,862,239 S581L probably benign Het
Ano8 A C 8: 71,483,243 D276E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Bpifb4 G A 2: 153,942,923 G184S probably damaging Het
Cbx8 T C 11: 119,039,311 D152G probably benign Het
Cdca2 A G 14: 67,705,629 probably null Het
Cgn G A 3: 94,773,635 A531V probably benign Het
Cmya5 C A 13: 93,045,866 probably null Het
Cntnap3 A G 13: 64,787,955 S365P probably damaging Het
Crnn A G 3: 93,149,023 Q372R probably damaging Het
Ehf T A 2: 103,266,779 E276V probably damaging Het
Eif4g3 T A 4: 138,163,433 probably null Het
Enpep C T 3: 129,309,099 D403N probably damaging Het
Enpp1 T C 10: 24,654,908 E550G probably damaging Het
Entpd8 A G 2: 25,084,334 D377G probably benign Het
Epc2 T A 2: 49,547,607 probably null Het
Erich3 G T 3: 154,733,573 G481V probably damaging Het
Fank1 A G 7: 133,869,346 Y156C probably damaging Het
Fras1 A G 5: 96,781,344 D3869G probably damaging Het
Gcnt2 A G 13: 40,918,199 D106G probably benign Het
Gm20830 A T Y: 6,916,501 V206E probably benign Het
Gmpr2 T C 14: 55,677,234 V228A possibly damaging Het
Gon4l TGAGCA TGAGCAGAGCA 3: 88,896,216 probably null Het
Gtpbp1 G A 15: 79,712,174 probably null Het
Hhat A T 1: 192,717,019 M271K probably damaging Het
Hipk2 A T 6: 38,818,875 M153K possibly damaging Het
Hydin A T 8: 110,535,283 H2672L probably benign Het
Igfbpl1 A T 4: 45,826,374 D140E probably damaging Het
Kctd1 T G 18: 15,063,516 probably benign Het
Lax1 A T 1: 133,680,578 Y142N probably damaging Het
Lpin2 C T 17: 71,244,803 R733C probably damaging Het
Morn4 A G 19: 42,076,117 L144P possibly damaging Het
Nup214 C A 2: 32,034,373 T1638K probably damaging Het
Nyap1 C T 5: 137,734,984 A596T probably damaging Het
Oas1d T C 5: 120,915,011 M43T probably benign Het
Olfr724 T C 14: 49,960,623 T150A probably benign Het
Olfr901 A G 9: 38,431,176 H298R probably benign Het
Olfr986 T C 9: 40,187,601 V162A probably benign Het
Pcdh17 A G 14: 84,446,360 Q89R probably damaging Het
Phrf1 A G 7: 141,258,465 probably benign Het
Plekhb1 A T 7: 100,655,395 I34N probably damaging Het
Ralgapa2 T C 2: 146,333,477 E1800G probably damaging Het
Rbm33 A T 5: 28,339,012 I89F probably damaging Het
Rtl1 T A 12: 109,594,097 E436V probably damaging Het
Slc2a4 G T 11: 69,946,391 P73Q probably damaging Het
Sorbs2 A T 8: 45,792,875 T311S probably benign Het
Sulf2 G A 2: 166,132,758 A2V probably benign Het
Supt16 A T 14: 52,174,144 probably null Het
Vmn1r26 A T 6: 58,008,753 N150K probably damaging Het
Vmn2r39 T A 7: 9,025,151 H407L possibly damaging Het
Vmn2r84 T A 10: 130,389,195 Y482F probably benign Het
Vps9d1 T C 8: 123,246,916 E376G probably benign Het
Wrn C A 8: 33,324,318 G366V probably benign Het
Other mutations in Pacs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Pacs1 APN 19 5153698 missense probably damaging 0.98
IGL01335:Pacs1 APN 19 5142632 missense probably damaging 1.00
IGL01717:Pacs1 APN 19 5167972 missense probably damaging 1.00
IGL02453:Pacs1 APN 19 5135005 missense probably damaging 1.00
IGL02887:Pacs1 APN 19 5135110 splice site probably benign
chicory UTSW 19 5139297 missense probably benign 0.33
endive UTSW 19 5272583 nonsense probably null
escarole UTSW 19 5156356 critical splice donor site probably null
frisee UTSW 19 5136791 missense probably damaging 1.00
R0240:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R0240:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R0316:Pacs1 UTSW 19 5135121 splice site silent
R0369:Pacs1 UTSW 19 5141698 missense probably damaging 1.00
R0443:Pacs1 UTSW 19 5272583 nonsense probably null
R0973:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R0973:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R0974:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R1202:Pacs1 UTSW 19 5135237 missense probably damaging 1.00
R1672:Pacs1 UTSW 19 5152309 missense probably benign 0.00
R1689:Pacs1 UTSW 19 5272615 unclassified probably benign
R1842:Pacs1 UTSW 19 5155884 missense probably damaging 0.96
R1847:Pacs1 UTSW 19 5153714 missense probably damaging 0.99
R3884:Pacs1 UTSW 19 5155759 missense probably damaging 0.99
R4577:Pacs1 UTSW 19 5143833 nonsense probably null
R4630:Pacs1 UTSW 19 5156356 critical splice donor site probably null
R5029:Pacs1 UTSW 19 5142271 missense probably benign 0.03
R5198:Pacs1 UTSW 19 5139297 missense probably benign 0.33
R5223:Pacs1 UTSW 19 5145141 missense probably benign 0.00
R5464:Pacs1 UTSW 19 5147207 missense probably benign
R6128:Pacs1 UTSW 19 5152372 splice site probably null
R6335:Pacs1 UTSW 19 5159977 missense probably damaging 1.00
R6802:Pacs1 UTSW 19 5152784 missense probably damaging 0.99
R6831:Pacs1 UTSW 19 5160795 missense probably damaging 1.00
R7071:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R7200:Pacs1 UTSW 19 5156413 missense possibly damaging 0.71
R7248:Pacs1 UTSW 19 5138975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAGCCTCAAGATCTGCATAC -3'
(R):5'- GGTTAGTCACTGAAGTCAAAGCC -3'

Sequencing Primer
(F):5'- CTTATCCAGAAGCAGATTTCGGC -3'
(R):5'- CACTGAAGTCAAAGCCAACATTTTG -3'
Posted On2016-11-09