Incidental Mutation 'R5658:Krt9'
ID443939
Institutional Source Beutler Lab
Gene Symbol Krt9
Ensembl Gene ENSMUSG00000051617
Gene Namekeratin 9
SynonymsKrt1-9, K9
MMRRC Submission 043172-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5658 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100186781-100193246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100190767 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 312 (I312T)
Ref Sequence ENSEMBL: ENSMUSP00000055255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059707]
Predicted Effect probably damaging
Transcript: ENSMUST00000059707
AA Change: I312T

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055255
Gene: ENSMUSG00000051617
AA Change: I312T

DomainStartEndE-ValueType
low complexity region 6 125 N/A INTRINSIC
Filament 130 442 2.96e-124 SMART
low complexity region 462 716 N/A INTRINSIC
low complexity region 721 737 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hyperpigmented calluses on the footpad with acanthosis, hyperkeratosis, thick epidermis and increased keratinocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,447 L221P probably damaging Het
Art2b A G 7: 101,580,362 V110A probably damaging Het
Bccip A G 7: 133,717,620 I147V possibly damaging Het
Bcl9l G T 9: 44,509,169 G1254W probably damaging Het
Cep68 C T 11: 20,241,885 probably null Het
Chst5 A G 8: 111,890,790 V66A probably damaging Het
F5 C A 1: 164,192,338 T794K probably damaging Het
Faf2 T C 13: 54,641,534 V55A probably benign Het
Gm7535 T A 17: 17,911,320 probably benign Het
Gm853 A G 4: 130,220,441 V61A probably benign Het
Gm9833 C T 3: 10,088,777 S202F probably damaging Het
Itpr3 T C 17: 27,107,878 V1471A possibly damaging Het
Kbtbd4 T A 2: 90,906,079 S145T probably benign Het
Kcnh3 C T 15: 99,242,076 P948S possibly damaging Het
Kcnq1 G A 7: 143,363,695 probably null Het
Kng2 T C 16: 22,997,020 probably null Het
Lactb2 T A 1: 13,627,418 H254L probably benign Het
Lama5 A T 2: 180,208,276 Y187* probably null Het
Maf1 T C 15: 76,353,220 V154A possibly damaging Het
Mlh1 A G 9: 111,247,380 V303A probably damaging Het
Mrgprh A T 17: 12,877,759 K295N possibly damaging Het
Mtrr G T 13: 68,568,915 A393D possibly damaging Het
Nebl A G 2: 17,348,852 Y963H probably damaging Het
Ormdl1 T C 1: 53,308,934 V145A probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Pmpcb A G 5: 21,739,001 T78A probably damaging Het
Ptprz1 G A 6: 23,016,189 R1677Q probably damaging Het
Rad54l2 ACCTCCTCCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTCCTCCTC 9: 106,753,992 probably benign Het
Ryr1 A T 7: 29,091,089 probably null Het
Sh3bp2 T A 5: 34,556,947 I162N probably damaging Het
Slc38a10 C T 11: 120,105,392 A960T probably benign Het
Sntb1 C T 15: 55,792,076 C248Y probably damaging Het
Sowahc G A 10: 59,223,227 R395H possibly damaging Het
Tbc1d5 T C 17: 50,813,841 R416G probably benign Het
Tnfaip6 A T 2: 52,051,035 Y196F possibly damaging Het
Tpo A G 12: 30,055,138 L911P possibly damaging Het
Try5 T C 6: 41,312,427 R72G probably damaging Het
Vwa8 T C 14: 78,982,398 probably null Het
Other mutations in Krt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Krt9 APN 11 100190006 missense probably damaging 1.00
IGL01695:Krt9 APN 11 100191437 critical splice donor site probably null
IGL02383:Krt9 APN 11 100191215 missense probably damaging 1.00
IGL02529:Krt9 APN 11 100189966 missense probably damaging 0.99
IGL02819:Krt9 APN 11 100191520 missense probably damaging 1.00
R1356:Krt9 UTSW 11 100188814 small insertion probably benign
R1397:Krt9 UTSW 11 100192638 missense probably damaging 1.00
R1498:Krt9 UTSW 11 100188369 nonsense probably null
R1772:Krt9 UTSW 11 100191305 missense probably damaging 0.99
R1871:Krt9 UTSW 11 100190788 missense probably damaging 1.00
R1883:Krt9 UTSW 11 100188697 missense unknown
R1985:Krt9 UTSW 11 100189991 missense probably benign 0.02
R2056:Krt9 UTSW 11 100191495 missense probably damaging 1.00
R2253:Krt9 UTSW 11 100190859 missense possibly damaging 0.83
R2305:Krt9 UTSW 11 100193116 missense unknown
R2875:Krt9 UTSW 11 100189205 nonsense probably null
R3813:Krt9 UTSW 11 100189677 missense probably damaging 1.00
R3874:Krt9 UTSW 11 100190849 missense probably damaging 1.00
R4157:Krt9 UTSW 11 100188649 missense unknown
R4762:Krt9 UTSW 11 100190849 missense probably damaging 1.00
R4873:Krt9 UTSW 11 100190037 missense probably benign 0.06
R4875:Krt9 UTSW 11 100190037 missense probably benign 0.06
R4923:Krt9 UTSW 11 100189077 small deletion probably benign
R4973:Krt9 UTSW 11 100188712 missense unknown
R5153:Krt9 UTSW 11 100191242 missense probably damaging 0.99
R5696:Krt9 UTSW 11 100189077 small deletion probably benign
R5944:Krt9 UTSW 11 100188439 missense unknown
R6147:Krt9 UTSW 11 100188839 missense unknown
R6403:Krt9 UTSW 11 100189659 missense probably damaging 0.99
R6476:Krt9 UTSW 11 100190814 missense probably damaging 1.00
R6822:Krt9 UTSW 11 100189077 small deletion probably benign
R7159:Krt9 UTSW 11 100189077 small deletion probably benign
R7174:Krt9 UTSW 11 100189077 small deletion probably benign
R7203:Krt9 UTSW 11 100190791 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACACAGCATCCATTGGAGG -3'
(R):5'- CTCACAGGTGGCATGCAATG -3'

Sequencing Primer
(F):5'- TCCATTGGAGGATGAAAGGATAGAGC -3'
(R):5'- CAGCTGTGCTTTGATTTCACAATG -3'
Posted On2016-11-09