Incidental Mutation 'R5659:Arhgap32'
ID443983
Institutional Source Beutler Lab
Gene Symbol Arhgap32
Ensembl Gene ENSMUSG00000041444
Gene NameRho GTPase activating protein 32
Synonymsp200RhoGAP, Grit, GC-GAP, PX-RICS, 3426406O18Rik
MMRRC Submission 043303-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5659 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location32116136-32268446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32181960 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 178 (V178D)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174641]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174314
Predicted Effect probably benign
Transcript: ENSMUST00000174641
AA Change: V203D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: V203D

DomainStartEndE-ValueType
Pfam:PX 132 226 5.6e-7 PFAM
SH3 262 320 7.4e-11 SMART
RhoGAP 383 564 9.6e-60 SMART
Blast:RhoGAP 581 647 9e-31 BLAST
low complexity region 867 882 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1262 1275 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1425 1442 N/A INTRINSIC
low complexity region 1653 1666 N/A INTRINSIC
low complexity region 2040 2049 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182310
AA Change: V178D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 T C 18: 36,561,050 S105P probably damaging Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Ap3b2 T A 7: 81,476,752 I367F probably damaging Het
Apaf1 A T 10: 91,062,153 C247* probably null Het
Aqp8 G A 7: 123,466,666 W228* probably null Het
Atp10b T A 11: 43,245,425 W1127R probably damaging Het
Bcl6 A T 16: 23,968,409 C580* probably null Het
Brd1 T C 15: 88,713,381 T568A probably benign Het
Brsk1 C T 7: 4,715,372 P665L possibly damaging Het
Cblc A G 7: 19,792,932 L125P probably damaging Het
Ccdc87 T C 19: 4,840,850 S457P probably damaging Het
Cxcr5 C T 9: 44,513,393 M322I probably benign Het
Cyb5r4 T A 9: 87,055,828 F300Y probably benign Het
Cyp3a25 T C 5: 145,991,546 T230A possibly damaging Het
Dhx9 A G 1: 153,471,735 V409A probably damaging Het
Dnah7b A G 1: 46,352,849 D3790G probably damaging Het
Gin1 A G 1: 97,775,532 T27A possibly damaging Het
Gipc1 A T 8: 83,664,126 M287L probably benign Het
Kat6a T A 8: 22,938,160 L1177* probably null Het
Klhl20 A G 1: 161,090,470 V82A probably damaging Het
Kmt2e T C 5: 23,497,807 I995T probably damaging Het
Lpin1 A T 12: 16,540,989 V814E probably damaging Het
Luzp1 T A 4: 136,542,476 V670D probably damaging Het
Lyst C A 13: 13,634,627 A294E possibly damaging Het
Olfr267 A T 4: 58,785,672 F17I probably damaging Het
Olfr3 A T 2: 36,812,954 I46N probably damaging Het
Olfr922 C T 9: 38,815,776 T91I probably benign Het
Olr1 T A 6: 129,500,029 E91V probably damaging Het
Pam T C 1: 97,842,299 Y476C probably damaging Het
Pcdhac1 T C 18: 37,092,417 L761P probably damaging Het
Phf21b C T 15: 84,793,900 W300* probably null Het
Pld2 T C 11: 70,557,561 *945Q probably null Het
Ppp1r37 C T 7: 19,535,523 V145M probably damaging Het
Rasgrf1 T A 9: 89,984,289 N593K probably damaging Het
Rhot1 T G 11: 80,250,355 probably null Het
Rmnd1 A T 10: 4,427,382 M99K probably benign Het
Ros1 G A 10: 52,143,386 T697I possibly damaging Het
Scgb1b10 G T 7: 32,100,878 A4S probably benign Het
Shc3 T C 13: 51,516,594 Y39C probably damaging Het
Slc25a23 A G 17: 57,045,500 probably benign Het
Slc5a8 C T 10: 88,919,428 L466F possibly damaging Het
Sqor G A 2: 122,787,603 C127Y probably benign Het
Sv2a G C 3: 96,190,303 W467S possibly damaging Het
Togaram2 G T 17: 71,687,672 D39Y probably damaging Het
Tspan11 T A 6: 127,938,277 probably null Het
Usp32 A G 11: 85,077,414 V141A possibly damaging Het
Zbtb38 T C 9: 96,687,420 H537R probably damaging Het
Zfat T C 15: 68,119,013 Y1008C probably damaging Het
Zfp637 G A 6: 117,843,330 G3E probably damaging Het
Zfp788 T A 7: 41,650,116 Y673* probably null Het
Zhx2 T C 15: 57,822,308 S358P probably benign Het
Other mutations in Arhgap32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgap32 APN 9 32257361 missense probably benign 0.00
IGL01317:Arhgap32 APN 9 32256964 missense probably benign 0.30
IGL01614:Arhgap32 APN 9 32260505 missense probably damaging 1.00
IGL01791:Arhgap32 APN 9 32247190 missense probably damaging 0.96
IGL02318:Arhgap32 APN 9 32259331 missense probably benign 0.00
IGL02542:Arhgap32 APN 9 32255648 missense probably damaging 1.00
IGL02568:Arhgap32 APN 9 32247194 missense probably damaging 1.00
IGL02627:Arhgap32 APN 9 32246006 missense probably damaging 1.00
IGL02927:Arhgap32 APN 9 32261135 missense possibly damaging 0.95
IGL03157:Arhgap32 APN 9 32259134 missense probably damaging 1.00
IGL03286:Arhgap32 APN 9 32259520 missense probably benign 0.06
PIT4445001:Arhgap32 UTSW 9 32260856 missense probably damaging 1.00
R0004:Arhgap32 UTSW 9 32151998 missense probably damaging 0.98
R0335:Arhgap32 UTSW 9 32259760 missense probably benign 0.00
R0380:Arhgap32 UTSW 9 32246477 missense probably damaging 1.00
R0396:Arhgap32 UTSW 9 32245255 critical splice donor site probably null
R0494:Arhgap32 UTSW 9 32258903 missense probably damaging 0.98
R0508:Arhgap32 UTSW 9 32190068 splice site probably benign
R0856:Arhgap32 UTSW 9 32260220 missense probably damaging 1.00
R0990:Arhgap32 UTSW 9 32255381 missense probably damaging 1.00
R1312:Arhgap32 UTSW 9 32255312 missense probably benign
R1455:Arhgap32 UTSW 9 32260085 missense probably benign 0.08
R1515:Arhgap32 UTSW 9 32116202 missense probably benign
R1523:Arhgap32 UTSW 9 32256752 missense probably damaging 1.00
R1651:Arhgap32 UTSW 9 32259800 missense probably damaging 1.00
R1743:Arhgap32 UTSW 9 32259431 missense probably benign 0.00
R1999:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2098:Arhgap32 UTSW 9 32259911 missense probably damaging 1.00
R2150:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2256:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2257:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2989:Arhgap32 UTSW 9 32239398 missense possibly damaging 0.54
R3780:Arhgap32 UTSW 9 32152019 splice site probably null
R3793:Arhgap32 UTSW 9 32255373 missense probably damaging 1.00
R3846:Arhgap32 UTSW 9 32190024 missense probably benign 0.03
R4086:Arhgap32 UTSW 9 32247066 unclassified probably benign
R4177:Arhgap32 UTSW 9 32247214 missense probably null 1.00
R4230:Arhgap32 UTSW 9 32257474 missense probably benign 0.10
R4280:Arhgap32 UTSW 9 32259889 missense probably damaging 0.98
R4504:Arhgap32 UTSW 9 32181839 splice site probably null
R4587:Arhgap32 UTSW 9 32260945 missense probably benign 0.02
R4612:Arhgap32 UTSW 9 32259479 missense probably damaging 0.99
R4622:Arhgap32 UTSW 9 32239348 missense possibly damaging 0.75
R4670:Arhgap32 UTSW 9 32170145 missense probably benign 0.03
R4784:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4784:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4785:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4785:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4906:Arhgap32 UTSW 9 32245256 critical splice donor site probably null
R5046:Arhgap32 UTSW 9 32256799 missense probably damaging 1.00
R5360:Arhgap32 UTSW 9 32259671 missense probably damaging 1.00
R5382:Arhgap32 UTSW 9 32152010 missense probably damaging 1.00
R5445:Arhgap32 UTSW 9 32248382 missense probably benign 0.19
R5637:Arhgap32 UTSW 9 32247206 missense probably damaging 1.00
R5801:Arhgap32 UTSW 9 32255788 missense probably benign 0.01
R6002:Arhgap32 UTSW 9 32256979 missense probably benign 0.00
R6109:Arhgap32 UTSW 9 32260111 missense probably damaging 1.00
R6405:Arhgap32 UTSW 9 32248488 missense probably benign 0.31
R6922:Arhgap32 UTSW 9 32152687 missense possibly damaging 0.86
R7009:Arhgap32 UTSW 9 32245976 missense probably damaging 1.00
R7137:Arhgap32 UTSW 9 32151936 missense probably benign 0.32
R7183:Arhgap32 UTSW 9 32186383 missense probably benign 0.15
R7251:Arhgap32 UTSW 9 32208185 missense probably damaging 1.00
R7287:Arhgap32 UTSW 9 32152697 missense
R7289:Arhgap32 UTSW 9 32256937 missense possibly damaging 0.92
R7289:Arhgap32 UTSW 9 32256938 missense probably benign 0.02
X0027:Arhgap32 UTSW 9 32250641 critical splice acceptor site probably null
X0063:Arhgap32 UTSW 9 32261069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTTACCGGAGTGTTTGGAGC -3'
(R):5'- ACAGCCACTGACACTTGTTTAC -3'

Sequencing Primer
(F):5'- GTTTGGAGCTGAACTGATTATCATC -3'
(R):5'- GTTTACTTCTGCACCCTAGAAAG -3'
Posted On2016-11-09