Incidental Mutation 'R5659:Olfr922'
ID443984
Institutional Source Beutler Lab
Gene Symbol Olfr922
Ensembl Gene ENSMUSG00000043911
Gene Nameolfactory receptor 922
SynonymsGA_x6K02T2PVTD-32518237-32519172, MOR161-3
MMRRC Submission 043303-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5659 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38814614-38819195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38815776 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 91 (T91I)
Ref Sequence ENSEMBL: ENSMUSP00000149057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051004] [ENSMUST00000213164]
Predicted Effect probably benign
Transcript: ENSMUST00000051004
AA Change: T91I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000057086
Gene: ENSMUSG00000043911
AA Change: T91I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.3e-52 PFAM
Pfam:7tm_1 41 290 3.4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213164
AA Change: T91I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 T C 18: 36,561,050 S105P probably damaging Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Ap3b2 T A 7: 81,476,752 I367F probably damaging Het
Apaf1 A T 10: 91,062,153 C247* probably null Het
Aqp8 G A 7: 123,466,666 W228* probably null Het
Arhgap32 T A 9: 32,181,960 V178D probably damaging Het
Atp10b T A 11: 43,245,425 W1127R probably damaging Het
Bcl6 A T 16: 23,968,409 C580* probably null Het
Brd1 T C 15: 88,713,381 T568A probably benign Het
Brsk1 C T 7: 4,715,372 P665L possibly damaging Het
Cblc A G 7: 19,792,932 L125P probably damaging Het
Ccdc87 T C 19: 4,840,850 S457P probably damaging Het
Cxcr5 C T 9: 44,513,393 M322I probably benign Het
Cyb5r4 T A 9: 87,055,828 F300Y probably benign Het
Cyp3a25 T C 5: 145,991,546 T230A possibly damaging Het
Dhx9 A G 1: 153,471,735 V409A probably damaging Het
Dnah7b A G 1: 46,352,849 D3790G probably damaging Het
Gin1 A G 1: 97,775,532 T27A possibly damaging Het
Gipc1 A T 8: 83,664,126 M287L probably benign Het
Kat6a T A 8: 22,938,160 L1177* probably null Het
Klhl20 A G 1: 161,090,470 V82A probably damaging Het
Kmt2e T C 5: 23,497,807 I995T probably damaging Het
Lpin1 A T 12: 16,540,989 V814E probably damaging Het
Luzp1 T A 4: 136,542,476 V670D probably damaging Het
Lyst C A 13: 13,634,627 A294E possibly damaging Het
Olfr267 A T 4: 58,785,672 F17I probably damaging Het
Olfr3 A T 2: 36,812,954 I46N probably damaging Het
Olr1 T A 6: 129,500,029 E91V probably damaging Het
Pam T C 1: 97,842,299 Y476C probably damaging Het
Pcdhac1 T C 18: 37,092,417 L761P probably damaging Het
Phf21b C T 15: 84,793,900 W300* probably null Het
Pld2 T C 11: 70,557,561 *945Q probably null Het
Ppp1r37 C T 7: 19,535,523 V145M probably damaging Het
Rasgrf1 T A 9: 89,984,289 N593K probably damaging Het
Rhot1 T G 11: 80,250,355 probably null Het
Rmnd1 A T 10: 4,427,382 M99K probably benign Het
Ros1 G A 10: 52,143,386 T697I possibly damaging Het
Scgb1b10 G T 7: 32,100,878 A4S probably benign Het
Shc3 T C 13: 51,516,594 Y39C probably damaging Het
Slc25a23 A G 17: 57,045,500 probably benign Het
Slc5a8 C T 10: 88,919,428 L466F possibly damaging Het
Sqor G A 2: 122,787,603 C127Y probably benign Het
Sv2a G C 3: 96,190,303 W467S possibly damaging Het
Togaram2 G T 17: 71,687,672 D39Y probably damaging Het
Tspan11 T A 6: 127,938,277 probably null Het
Usp32 A G 11: 85,077,414 V141A possibly damaging Het
Zbtb38 T C 9: 96,687,420 H537R probably damaging Het
Zfat T C 15: 68,119,013 Y1008C probably damaging Het
Zfp637 G A 6: 117,843,330 G3E probably damaging Het
Zfp788 T A 7: 41,650,116 Y673* probably null Het
Zhx2 T C 15: 57,822,308 S358P probably benign Het
Other mutations in Olfr922
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Olfr922 APN 9 38816039 missense probably damaging 0.99
IGL02445:Olfr922 APN 9 38815605 missense possibly damaging 0.57
R1758:Olfr922 UTSW 9 38815575 missense probably benign
R1759:Olfr922 UTSW 9 38815898 missense probably damaging 1.00
R1809:Olfr922 UTSW 9 38816147 missense probably benign
R1938:Olfr922 UTSW 9 38815850 missense probably benign 0.33
R2177:Olfr922 UTSW 9 38816186 missense possibly damaging 0.82
R3438:Olfr922 UTSW 9 38816216 missense probably damaging 0.99
R3815:Olfr922 UTSW 9 38816426 missense possibly damaging 0.47
R3816:Olfr922 UTSW 9 38816426 missense possibly damaging 0.47
R3817:Olfr922 UTSW 9 38816426 missense possibly damaging 0.47
R3819:Olfr922 UTSW 9 38816426 missense possibly damaging 0.47
R3859:Olfr922 UTSW 9 38816147 missense probably benign
R4768:Olfr922 UTSW 9 38815949 missense probably damaging 1.00
R5082:Olfr922 UTSW 9 38816145 missense possibly damaging 0.70
R5813:Olfr922 UTSW 9 38815656 missense probably benign 0.00
R6226:Olfr922 UTSW 9 38816370 missense probably damaging 0.99
R7240:Olfr922 UTSW 9 38815713 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATCTATGCTATCACAGTGGCAG -3'
(R):5'- CAGCCTCATCATGCAACCTG -3'

Sequencing Primer
(F):5'- TCTATGCTATCACAGTGGCAGGAAAC -3'
(R):5'- CTCATCATGCAACCTGTGTGGG -3'
Posted On2016-11-09