Incidental Mutation 'R5660:Abcc8'
ID444033
Institutional Source Beutler Lab
Gene Symbol Abcc8
Ensembl Gene ENSMUSG00000040136
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 8
SynonymsD930031B21Rik, SUR1, Sur
MMRRC Submission 043173-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.541) question?
Stock #R5660 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location46104523-46180033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46108404 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1307 (N1307S)
Ref Sequence ENSEMBL: ENSMUSP00000033123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033123]
Predicted Effect probably benign
Transcript: ENSMUST00000033123
AA Change: N1307S

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000033123
Gene: ENSMUSG00000040136
AA Change: N1307S

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
transmembrane domain 105 124 N/A INTRINSIC
transmembrane domain 131 148 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 299 590 1.3e-39 PFAM
AAA 705 920 4.46e-14 SMART
low complexity region 972 994 N/A INTRINSIC
Pfam:ABC_membrane 1019 1301 1.3e-49 PFAM
AAA 1377 1570 4.33e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210637
Predicted Effect unknown
Transcript: ENSMUST00000210655
AA Change: N628S
Predicted Effect probably benign
Transcript: ENSMUST00000210770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211039
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a modulator of ATP-sensitive potassium channels and insulin release. Mutations and deficiencies in this protein have been observed in patients with hyperinsulinemic hypoglycemia of infancy, an autosomal recessive disorder of unregulated and high insulin secretion. Mutations have also been associated with non-insulin-dependent diabetes mellitus type II, an autosomal dominant disease of defective insulin secretion. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a transient neonatal hypoglycemia and a late-developing glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A T 17: 35,963,647 D41E possibly damaging Het
Adamts13 T C 2: 26,996,749 V966A probably benign Het
Adamts2 A T 11: 50,776,645 D470V probably damaging Het
Adar T C 3: 89,735,594 F261L probably damaging Het
Akap3 C T 6: 126,865,291 A291V probably damaging Het
Akr1c6 G A 13: 4,449,054 V214I probably benign Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Arhgap11a T A 2: 113,841,910 I238F possibly damaging Het
Atg2b A T 12: 105,649,124 Y1024* probably null Het
Cad T A 5: 31,076,847 D1956E probably damaging Het
Cbs A T 17: 31,624,246 I237N probably damaging Het
Ccdc81 T C 7: 89,893,129 T180A probably benign Het
Cftr T A 6: 18,313,687 N1303K probably benign Het
Col6a4 A G 9: 105,996,116 S2227P probably benign Het
Crebbp A T 16: 4,154,858 M324K possibly damaging Het
Dst A G 1: 34,282,493 K4363R probably damaging Het
Eif2b4 A T 5: 31,191,156 Y238N probably benign Het
Fam83c G A 2: 155,829,589 A642V probably benign Het
Fat2 T A 11: 55,284,176 T1904S probably benign Het
Flt3 T C 5: 147,369,481 N279S possibly damaging Het
Galnt4 A G 10: 99,109,535 N374S probably benign Het
Gm14401 T A 2: 177,086,431 H103Q probably damaging Het
Gm5422 A T 10: 31,250,052 noncoding transcript Het
Helb G A 10: 120,111,079 Q110* probably null Het
Ido1 T C 8: 24,591,542 D41G probably damaging Het
Igfn1 A G 1: 135,970,414 S805P probably benign Het
Matr3 C A 18: 35,572,094 A24E probably damaging Het
Mmp23 C T 4: 155,651,253 C287Y probably damaging Het
Mrnip A G 11: 50,197,091 R147G probably null Het
Msh6 A G 17: 87,984,719 K301E possibly damaging Het
Olfr103 A G 17: 37,336,644 L196P probably damaging Het
Olfr967 G A 9: 39,750,767 C127Y probably damaging Het
Ptar1 T A 19: 23,694,412 C60S probably benign Het
Rora A G 9: 68,653,921 S11G probably benign Het
Rps6ka5 G T 12: 100,619,580 H151Q possibly damaging Het
Sgsh A G 11: 119,350,981 S100P probably damaging Het
Simc1 A G 13: 54,547,089 T1229A probably benign Het
Slc26a11 T C 11: 119,357,978 Y62H probably damaging Het
Slc5a8 C T 10: 88,919,428 L466F possibly damaging Het
Smg1 C T 7: 118,143,347 V3215I probably benign Het
Smyd2 G A 1: 189,885,382 P285L possibly damaging Het
Themis2 T C 4: 132,796,256 probably null Het
Tln1 A G 4: 43,547,732 V743A probably damaging Het
Tpo T A 12: 30,100,496 N462Y possibly damaging Het
Wnt2 T A 6: 18,028,146 M30L probably benign Het
Zfyve9 T C 4: 108,719,168 I239V probably benign Het
Other mutations in Abcc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Abcc8 APN 7 46104664 missense probably benign
IGL01457:Abcc8 APN 7 46135493 missense possibly damaging 0.51
IGL01645:Abcc8 APN 7 46115053 missense possibly damaging 0.93
IGL01683:Abcc8 APN 7 46151667 missense possibly damaging 0.78
IGL01826:Abcc8 APN 7 46124849 missense probably benign 0.01
IGL01912:Abcc8 APN 7 46120510 missense probably damaging 1.00
IGL02218:Abcc8 APN 7 46120436 missense probably benign 0.00
IGL02326:Abcc8 APN 7 46122857 critical splice donor site probably null
IGL02403:Abcc8 APN 7 46105803 splice site probably null
IGL02411:Abcc8 APN 7 46107007 missense probably damaging 1.00
IGL02653:Abcc8 APN 7 46115767
IGL02706:Abcc8 APN 7 46166921 missense probably benign 0.08
R0295:Abcc8 UTSW 7 46118054 missense probably benign
R0381:Abcc8 UTSW 7 46108434 missense possibly damaging 0.46
R0391:Abcc8 UTSW 7 46122173 missense probably damaging 0.98
R0408:Abcc8 UTSW 7 46107033 missense probably damaging 0.99
R0496:Abcc8 UTSW 7 46108820 missense probably damaging 1.00
R1126:Abcc8 UTSW 7 46109638 missense probably damaging 0.99
R1323:Abcc8 UTSW 7 46117362 missense probably benign 0.07
R1323:Abcc8 UTSW 7 46117362 missense probably benign 0.07
R1352:Abcc8 UTSW 7 46135468 splice site probably benign
R1368:Abcc8 UTSW 7 46122860 missense probably damaging 1.00
R1437:Abcc8 UTSW 7 46179813 missense probably damaging 1.00
R1463:Abcc8 UTSW 7 46154512 missense probably benign 0.12
R1689:Abcc8 UTSW 7 46120403 missense probably benign 0.16
R1717:Abcc8 UTSW 7 46115815 missense possibly damaging 0.91
R1804:Abcc8 UTSW 7 46120479 missense probably benign 0.02
R1848:Abcc8 UTSW 7 46166902 missense probably benign
R1870:Abcc8 UTSW 7 46123915 missense probably benign 0.05
R1938:Abcc8 UTSW 7 46175371 missense possibly damaging 0.49
R1993:Abcc8 UTSW 7 46117423 splice site probably null
R1994:Abcc8 UTSW 7 46157119 missense probably benign 0.02
R2511:Abcc8 UTSW 7 46150780 missense probably damaging 1.00
R3840:Abcc8 UTSW 7 46108100 missense possibly damaging 0.67
R3879:Abcc8 UTSW 7 46104627 missense possibly damaging 0.90
R4444:Abcc8 UTSW 7 46136194 missense probably benign 0.09
R4463:Abcc8 UTSW 7 46106581 splice site probably null
R4761:Abcc8 UTSW 7 46113075 missense probably damaging 1.00
R4816:Abcc8 UTSW 7 46104707 missense probably benign 0.01
R4841:Abcc8 UTSW 7 46150828 missense probably damaging 1.00
R4842:Abcc8 UTSW 7 46150828 missense probably damaging 1.00
R4870:Abcc8 UTSW 7 46107259 nonsense probably null
R4969:Abcc8 UTSW 7 46105519 missense probably benign 0.02
R4975:Abcc8 UTSW 7 46150867 missense probably damaging 0.98
R5258:Abcc8 UTSW 7 46108387 missense probably benign
R5258:Abcc8 UTSW 7 46157148 missense probably benign 0.17
R5502:Abcc8 UTSW 7 46108838 missense probably benign 0.00
R5518:Abcc8 UTSW 7 46120449 missense probably benign
R5902:Abcc8 UTSW 7 46115039 missense probably benign
R5907:Abcc8 UTSW 7 46123906 missense probably benign 0.01
R6023:Abcc8 UTSW 7 46108419 missense possibly damaging 0.62
R6026:Abcc8 UTSW 7 46167000 missense probably benign
R6078:Abcc8 UTSW 7 46105844 missense probably benign 0.01
R6079:Abcc8 UTSW 7 46105844 missense probably benign 0.01
R6103:Abcc8 UTSW 7 46119021 missense possibly damaging 0.50
R6221:Abcc8 UTSW 7 46175450 missense probably benign 0.01
R6511:Abcc8 UTSW 7 46150861 missense possibly damaging 0.82
U15987:Abcc8 UTSW 7 46105844 missense probably benign 0.01
Z1088:Abcc8 UTSW 7 46138065 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTTGGGGATCAATGACGG -3'
(R):5'- TCATGGCTCCAGGTTGCTAC -3'

Sequencing Primer
(F):5'- TCAATGACGGTGCTGAGGGC -3'
(R):5'- AGGTTGCTACTGTCCCCAG -3'
Posted On2016-11-09