Incidental Mutation 'R5662:Paxbp1'
ID444165
Institutional Source Beutler Lab
Gene Symbol Paxbp1
Ensembl Gene ENSMUSG00000022974
Gene NamePAX3 and PAX7 binding protein 1
Synonyms
MMRRC Submission 043305-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R5662 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location91014037-91044543 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 91037397 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 167 (T167M)
Ref Sequence ENSEMBL: ENSMUSP00000113835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118522]
Predicted Effect unknown
Transcript: ENSMUST00000023698
AA Change: T103M
SMART Domains Protein: ENSMUSP00000023698
Gene: ENSMUSG00000022974
AA Change: T103M

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 51 57 N/A INTRINSIC
low complexity region 60 86 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 434 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118522
AA Change: T167M

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113835
Gene: ENSMUSG00000022974
AA Change: T167M

DomainStartEndE-ValueType
coiled coil region 3 28 N/A INTRINSIC
low complexity region 114 120 N/A INTRINSIC
low complexity region 123 149 N/A INTRINSIC
low complexity region 186 199 N/A INTRINSIC
low complexity region 258 271 N/A INTRINSIC
low complexity region 525 546 N/A INTRINSIC
Pfam:GCFC 597 812 5.1e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127002
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may bind to GC-rich DNA sequences, which suggests its involvement in the regulation of transcription. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,100,107 V1542D possibly damaging Het
Acsm4 T G 7: 119,694,800 N131K possibly damaging Het
Ankrd54 A G 15: 79,062,614 S62P possibly damaging Het
Ccdc186 A G 19: 56,793,488 I753T probably benign Het
Cers2 C T 3: 95,320,984 R112C probably damaging Het
Col6a4 C G 9: 106,068,001 R971S probably damaging Het
Ctsf T C 19: 4,856,578 S178P probably damaging Het
D430042O09Rik A G 7: 125,842,703 R595G probably benign Het
Dennd4c C T 4: 86,795,288 T492I probably benign Het
Dhx8 A G 11: 101,766,758 K1212E possibly damaging Het
Dnah8 A G 17: 30,737,333 T2096A probably damaging Het
Ephb4 A T 5: 137,372,195 I886F probably damaging Het
Eprs T G 1: 185,394,425 N519K possibly damaging Het
Fam3c T C 6: 22,355,062 probably benign Het
Galnt17 G A 5: 131,086,006 R219C probably damaging Het
Gm10645 A G 8: 83,165,857 probably benign Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Hydin T G 8: 110,580,709 S3907A probably benign Het
Ighv1-49 A T 12: 115,055,407 V56E probably damaging Het
Igtp A G 11: 58,206,279 D92G probably damaging Het
Itga1 C T 13: 114,986,171 V750I probably benign Het
Kif3c T A 12: 3,367,031 Y351N probably damaging Het
Klhdc1 T A 12: 69,283,165 I356N probably benign Het
Lrrc34 T C 3: 30,631,324 Y292C probably benign Het
Ly75 G A 2: 60,352,381 T526M probably damaging Het
Mroh4 A T 15: 74,625,428 D181E possibly damaging Het
Nutm1 T C 2: 112,249,300 N757D probably benign Het
Olfr24 A G 9: 18,755,600 F12L probably damaging Het
Olfr384 T C 11: 73,603,179 F200L probably benign Het
Olfr466 T C 13: 65,152,253 F10L possibly damaging Het
Olfr811 T C 10: 129,802,307 T73A possibly damaging Het
Pnpla7 A G 2: 25,052,384 D1238G probably damaging Het
Pom121l2 T C 13: 21,982,188 S210P probably benign Het
Ripor3 T G 2: 167,993,556 N165T probably benign Het
Serpine3 T G 14: 62,670,842 S106R probably benign Het
Slc25a11 G A 11: 70,645,419 R158* probably null Het
Slc26a6 G A 9: 108,859,339 V506M possibly damaging Het
Slc45a2 A G 15: 11,022,083 K304E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Smarcb1 T C 10: 75,904,570 N267S possibly damaging Het
Spink6 C A 18: 44,074,414 Q24K possibly damaging Het
Srebf2 T C 15: 82,195,003 S811P probably benign Het
Ssc4d A G 5: 135,960,894 *587R probably null Het
Sult2a8 C T 7: 14,427,840 R27H probably benign Het
Sun2 C T 15: 79,738,868 A90T probably benign Het
Ubr7 T C 12: 102,768,267 S267P probably benign Het
Wdr55 G A 18: 36,760,395 V37M possibly damaging Het
Xdh C T 17: 73,941,115 G45S probably damaging Het
Zfp638 T A 6: 83,943,129 S570T probably damaging Het
Other mutations in Paxbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Paxbp1 APN 16 91035916 splice site probably benign
IGL01705:Paxbp1 APN 16 91016988 missense probably benign 0.01
IGL02418:Paxbp1 APN 16 91034112 missense probably damaging 1.00
IGL02527:Paxbp1 APN 16 91037273 missense possibly damaging 0.57
IGL02661:Paxbp1 APN 16 91030525 missense probably benign 0.43
IGL02796:Paxbp1 APN 16 91025294 unclassified probably benign
IGL03336:Paxbp1 APN 16 91034172 missense probably benign
R0016:Paxbp1 UTSW 16 91036036 splice site probably benign
R0306:Paxbp1 UTSW 16 91022115 missense possibly damaging 0.54
R0331:Paxbp1 UTSW 16 91037367 missense possibly damaging 0.95
R0724:Paxbp1 UTSW 16 91036536 missense probably damaging 1.00
R0944:Paxbp1 UTSW 16 91023427 missense probably benign 0.25
R1348:Paxbp1 UTSW 16 91035016 missense probably damaging 0.97
R1909:Paxbp1 UTSW 16 91044305 unclassified probably benign
R2234:Paxbp1 UTSW 16 91034934 missense probably benign 0.05
R3156:Paxbp1 UTSW 16 91035990 missense probably benign 0.00
R3819:Paxbp1 UTSW 16 91022752 unclassified probably benign
R3910:Paxbp1 UTSW 16 91042681 missense probably damaging 1.00
R3949:Paxbp1 UTSW 16 91044017 missense probably damaging 1.00
R4109:Paxbp1 UTSW 16 91016898 missense probably benign 0.10
R4577:Paxbp1 UTSW 16 91015154 missense probably damaging 1.00
R4584:Paxbp1 UTSW 16 91034123 missense probably damaging 1.00
R4596:Paxbp1 UTSW 16 91030547 missense probably benign 0.28
R4837:Paxbp1 UTSW 16 91034978 nonsense probably null
R4877:Paxbp1 UTSW 16 91044311 unclassified probably benign
R5079:Paxbp1 UTSW 16 91025146 critical splice donor site probably null
R5086:Paxbp1 UTSW 16 91015216 unclassified probably benign
R5167:Paxbp1 UTSW 16 91022667 critical splice donor site probably null
R5291:Paxbp1 UTSW 16 91044352 start codon destroyed probably null
R5322:Paxbp1 UTSW 16 91015162 missense probably benign 0.01
R5529:Paxbp1 UTSW 16 91030513 missense possibly damaging 0.62
R5814:Paxbp1 UTSW 16 91030496 missense probably damaging 1.00
R6422:Paxbp1 UTSW 16 91023444 missense probably benign 0.07
R7225:Paxbp1 UTSW 16 91027068 missense probably damaging 1.00
X0026:Paxbp1 UTSW 16 91027242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCCTGTAAGCACTCACCTG -3'
(R):5'- CTGCACAGGATTACCTAGTGAG -3'

Sequencing Primer
(F):5'- TAAGCACTCACCTGGGCGG -3'
(R):5'- GCACAGGATTACCTAGTGAGATTTTG -3'
Posted On2016-11-09