Incidental Mutation 'R5664:Capn3'
ID444236
Institutional Source Beutler Lab
Gene Symbol Capn3
Ensembl Gene ENSMUSG00000079110
Gene Namecalpain 3
SynonymsCapa-3, Capa3, Lp82, p94
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.472) question?
Stock #R5664 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location120456019-120504913 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120477025 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 15 (R15Q)
Ref Sequence ENSEMBL: ENSMUSP00000106347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028748] [ENSMUST00000028749] [ENSMUST00000090028] [ENSMUST00000110716] [ENSMUST00000110719] [ENSMUST00000110721]
Predicted Effect probably benign
Transcript: ENSMUST00000028748
AA Change: R15Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000028748
Gene: ENSMUSG00000079110
AA Change: R15Q

DomainStartEndE-ValueType
CysPc 32 357 5.98e-199 SMART
calpain_III 360 514 4.27e-90 SMART
EFh 584 612 5.53e-4 SMART
EFh 614 642 1.8e-3 SMART
EFh 679 707 4.32e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000028749
SMART Domains Protein: ENSMUSP00000028749
Gene: ENSMUSG00000079110

DomainStartEndE-ValueType
CysPc 56 425 2.09e-212 SMART
calpain_III 428 582 4.27e-90 SMART
Pfam:Calpain_u2 583 653 1.3e-31 PFAM
EFh 696 724 5.53e-4 SMART
EFh 726 754 1.8e-3 SMART
EFh 791 819 4.32e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090028
AA Change: R15Q

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000087482
Gene: ENSMUSG00000079110
AA Change: R15Q

DomainStartEndE-ValueType
CysPc 32 357 5.98e-199 SMART
calpain_III 360 514 4.27e-90 SMART
low complexity region 585 599 N/A INTRINSIC
EFh 612 640 5.53e-4 SMART
EFh 642 670 1.8e-3 SMART
EFh 707 735 4.32e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110716
AA Change: R15Q

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106344
Gene: ENSMUSG00000079110
AA Change: R15Q

DomainStartEndE-ValueType
CysPc 32 405 8.38e-203 SMART
calpain_III 408 562 4.27e-90 SMART
EFh 632 660 5.53e-4 SMART
EFh 662 690 1.8e-3 SMART
EFh 727 755 4.32e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110719
AA Change: R15Q

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106347
Gene: ENSMUSG00000079110
AA Change: R15Q

DomainStartEndE-ValueType
CysPc 32 405 8.38e-203 SMART
calpain_III 408 562 4.27e-90 SMART
low complexity region 633 647 N/A INTRINSIC
EFh 660 688 5.53e-4 SMART
EFh 690 718 1.8e-3 SMART
EFh 755 783 4.32e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110721
SMART Domains Protein: ENSMUSP00000106349
Gene: ENSMUSG00000079110

DomainStartEndE-ValueType
CysPc 56 377 1.13e-208 SMART
calpain_III 380 534 4.27e-90 SMART
EFh 604 632 5.53e-4 SMART
EFh 634 662 1.8e-3 SMART
EFh 699 727 4.32e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145993
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpain, a heterodimer consisting of a large and a small subunit, is a major intracellular protease, although its function has not been well established. This gene encodes a muscle-specific member of the calpain large subunit family that specifically binds to titin. Mutations in this gene are associated with limb-girdle muscular dystrophies type 2A. Alternate promoters and alternative splicing result in multiple transcript variants encoding different isoforms and some variants are ubiquitously expressed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in muscle dystrophy. The psoas, soleus, and deltoid muscles are the most severely affected. The mutant allele appears to be preferentially transmitted resulting in ratio distortion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,994 probably null Het
1810032O08Rik A T 11: 116,672,664 T27S possibly damaging Het
4930432K21Rik A T 8: 84,166,659 I152F probably benign Het
9430015G10Rik T A 4: 156,123,559 L112H probably damaging Het
Acaca T C 11: 84,243,384 L441P probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arsj A T 3: 126,438,657 I351F probably damaging Het
Atp6v1b2 A G 8: 69,107,620 T373A probably damaging Het
Atr C A 9: 95,905,813 N1486K probably benign Het
Avl9 T C 6: 56,753,839 S583P probably damaging Het
Bptf A T 11: 107,073,699 D1493E probably benign Het
C2cd2l T C 9: 44,313,772 E548G probably damaging Het
Ccl3 A G 11: 83,649,213 F22S probably benign Het
Clcf1 T C 19: 4,222,096 F69S probably damaging Het
Col13a1 T C 10: 61,851,116 E170G probably damaging Het
Dhx29 T A 13: 112,946,879 F489L probably damaging Het
Dhx8 A T 11: 101,740,751 N390I probably damaging Het
Dkk1 T A 19: 30,548,789 Y135F probably benign Het
Edil3 G T 13: 89,319,713 V446F probably damaging Het
Epha5 T A 5: 84,331,866 E93V probably damaging Het
Epsti1 C T 14: 77,963,664 T196I possibly damaging Het
Fras1 T C 5: 96,728,535 S2376P possibly damaging Het
Frem2 A G 3: 53,652,490 V1532A probably benign Het
Fsip2 T A 2: 82,988,095 M4724K probably benign Het
Gcat T A 15: 79,043,073 L238Q probably damaging Het
Gimap6 T C 6: 48,702,275 K276E probably benign Het
Gjb5 T A 4: 127,355,929 I141F probably benign Het
Glt6d1 T C 2: 25,814,180 I7V probably benign Het
Gm37596 A G 3: 93,692,687 F125S probably benign Het
Gm5771 C T 6: 41,394,671 P17L probably benign Het
Gm6169 C A 13: 97,099,121 L39F probably damaging Het
Gtf2h5 G A 17: 6,084,524 G30R probably damaging Het
Herc6 C A 6: 57,618,684 T449K probably benign Het
Hpn A T 7: 31,099,262 Y132N probably damaging Het
Hpx A T 7: 105,595,148 M190K probably benign Het
Inf2 A G 12: 112,611,728 H1151R unknown Het
Krt74 A G 15: 101,760,579 noncoding transcript Het
Loxl3 G A 6: 83,049,882 S564N probably benign Het
Map7 T A 10: 20,267,359 V418E unknown Het
Mrpl37 T C 4: 107,064,391 N214D probably benign Het
Mthfr T C 4: 148,055,466 Y656H probably damaging Het
Myo9b A G 8: 71,359,882 D2099G probably benign Het
Nktr T A 9: 121,749,417 C825* probably null Het
Nomo1 A G 7: 46,076,157 E1029G probably benign Het
Nup133 T C 8: 123,906,281 D1037G probably benign Het
Olfr1271 A G 2: 90,265,615 F272L probably damaging Het
Olfr153 T C 2: 87,532,834 L267P probably benign Het
Pcdhb14 T A 18: 37,448,996 V385D possibly damaging Het
Pik3c2g T C 6: 139,737,007 L38P probably damaging Het
Pkd1 A T 17: 24,569,371 D701V probably damaging Het
Pnpla6 A G 8: 3,537,478 T1070A probably damaging Het
Ppl T C 16: 5,106,055 D185G probably benign Het
Prune1 A T 3: 95,258,178 L261Q probably damaging Het
Qser1 A T 2: 104,778,196 L1444I probably damaging Het
Serpina6 A C 12: 103,654,467 C8G probably damaging Het
Sla2 A T 2: 156,874,999 D180E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Tbx3 A G 5: 119,678,731 K311R possibly damaging Het
Thbs2 A T 17: 14,689,837 C167S probably damaging Het
Trak1 T A 9: 121,472,307 C710S possibly damaging Het
Tsks G A 7: 44,953,784 E337K probably damaging Het
Vcpip1 A G 1: 9,746,379 I593T probably damaging Het
Vmn2r118 A G 17: 55,592,765 I713T possibly damaging Het
Vmn2r23 C T 6: 123,713,074 T303M probably damaging Het
Vmn2r68 A T 7: 85,233,770 M258K probably benign Het
Vmn2r76 A G 7: 86,245,994 probably null Het
Wap A G 11: 6,638,609 I5T possibly damaging Het
Zfp235 A C 7: 24,142,151 H665P probably damaging Het
Other mutations in Capn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Capn3 APN 2 120486482 intron probably benign
IGL00976:Capn3 APN 2 120491901 missense possibly damaging 0.81
IGL01538:Capn3 APN 2 120502186 splice site probably null
IGL01564:Capn3 APN 2 120480708 missense probably damaging 1.00
IGL02527:Capn3 APN 2 120504485 missense probably damaging 0.99
IGL02605:Capn3 APN 2 120496037 missense probably damaging 0.98
IGL02678:Capn3 APN 2 120502998 missense probably damaging 1.00
IGL02899:Capn3 APN 2 120491901 missense possibly damaging 0.81
IGL03255:Capn3 APN 2 120489708 missense probably damaging 1.00
R0053:Capn3 UTSW 2 120491837 missense possibly damaging 0.95
R0053:Capn3 UTSW 2 120491837 missense possibly damaging 0.95
R0096:Capn3 UTSW 2 120502529 missense possibly damaging 0.94
R0096:Capn3 UTSW 2 120502529 missense possibly damaging 0.94
R0276:Capn3 UTSW 2 120488065 splice site probably benign
R0601:Capn3 UTSW 2 120502596 splice site probably null
R0714:Capn3 UTSW 2 120491880 missense probably benign 0.32
R1217:Capn3 UTSW 2 120486421 nonsense probably null
R1530:Capn3 UTSW 2 120482208 missense probably damaging 1.00
R1566:Capn3 UTSW 2 120502993 missense possibly damaging 0.72
R1745:Capn3 UTSW 2 120489689 missense possibly damaging 0.87
R1748:Capn3 UTSW 2 120497013 missense probably benign 0.10
R1861:Capn3 UTSW 2 120486482 intron probably benign
R1960:Capn3 UTSW 2 120463940 missense probably benign 0.00
R1971:Capn3 UTSW 2 120480747 missense possibly damaging 0.95
R1994:Capn3 UTSW 2 120495937 missense probably damaging 1.00
R2043:Capn3 UTSW 2 120491901 missense possibly damaging 0.81
R2254:Capn3 UTSW 2 120501251 missense probably benign 0.01
R2255:Capn3 UTSW 2 120501251 missense probably benign 0.01
R3738:Capn3 UTSW 2 120485287 missense possibly damaging 0.85
R3824:Capn3 UTSW 2 120484483 splice site probably benign
R4796:Capn3 UTSW 2 120502998 missense probably damaging 1.00
R5073:Capn3 UTSW 2 120491820 missense probably damaging 1.00
R5116:Capn3 UTSW 2 120485292 missense probably benign 0.00
R5152:Capn3 UTSW 2 120501330 intron probably benign
R5420:Capn3 UTSW 2 120495296 intron probably benign
R5478:Capn3 UTSW 2 120464185 splice site probably null
R5506:Capn3 UTSW 2 120502420 missense probably damaging 0.97
R5733:Capn3 UTSW 2 120484594 nonsense probably null
R6212:Capn3 UTSW 2 120477186 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGACCACAGCCTTTCTCTGG -3'
(R):5'- TTGGCCTCTTCCAAGTGATG -3'

Sequencing Primer
(F):5'- GACCGTGTTCATTTGCATCAAG -3'
(R):5'- GATGGCCTTCATCTTGGCTTTCTG -3'
Posted On2016-11-09