Incidental Mutation 'R5664:Tbx3'
ID444250
Institutional Source Beutler Lab
Gene Symbol Tbx3
Ensembl Gene ENSMUSG00000018604
Gene NameT-box 3
SynonymsD5Ertd189e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5664 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location119670669-119684724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119678731 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 311 (K311R)
Ref Sequence ENSEMBL: ENSMUSP00000078657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018748] [ENSMUST00000079719] [ENSMUST00000121021]
Predicted Effect probably benign
Transcript: ENSMUST00000018748
AA Change: K331R

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000018748
Gene: ENSMUSG00000018604
AA Change: K331R

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
TBOX 102 310 6.4e-125 SMART
Pfam:TBX 323 411 8.8e-29 PFAM
low complexity region 492 510 N/A INTRINSIC
low complexity region 524 538 N/A INTRINSIC
low complexity region 556 576 N/A INTRINSIC
low complexity region 607 620 N/A INTRINSIC
low complexity region 662 710 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079719
AA Change: K311R

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078657
Gene: ENSMUSG00000018604
AA Change: K311R

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
TBOX 102 290 1.01e-127 SMART
Pfam:TBX 303 391 6.5e-29 PFAM
low complexity region 472 490 N/A INTRINSIC
low complexity region 504 518 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 587 600 N/A INTRINSIC
low complexity region 642 690 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121021
AA Change: K311R

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112519
Gene: ENSMUSG00000018604
AA Change: K311R

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
TBOX 102 290 1.01e-127 SMART
Pfam:TBX 303 391 6.5e-29 PFAM
low complexity region 472 490 N/A INTRINSIC
low complexity region 504 518 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 587 600 N/A INTRINSIC
low complexity region 642 690 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154680
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This protein is a transcriptional repressor and is thought to play a role in the anterior/posterior axis of the tetrapod forelimb. Mutations in this gene cause ulnar-mammary syndrome, affecting limb, apocrine gland, tooth, hair, and genital development. Alternative splicing of this gene results in three transcript variants encoding different isoforms; however, the full length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die are embryonic lethal exhibiting defects in the yolk sac and limb defects. Female embryos show impaired mammary bud induction. Mice homozygous for hypomorphic alleles exhibit varying degrees of prenatal lethality and premature death, heart defects and limb abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,994 probably null Het
1810032O08Rik A T 11: 116,672,664 T27S possibly damaging Het
4930432K21Rik A T 8: 84,166,659 I152F probably benign Het
9430015G10Rik T A 4: 156,123,559 L112H probably damaging Het
Acaca T C 11: 84,243,384 L441P probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arsj A T 3: 126,438,657 I351F probably damaging Het
Atp6v1b2 A G 8: 69,107,620 T373A probably damaging Het
Atr C A 9: 95,905,813 N1486K probably benign Het
Avl9 T C 6: 56,753,839 S583P probably damaging Het
Bptf A T 11: 107,073,699 D1493E probably benign Het
C2cd2l T C 9: 44,313,772 E548G probably damaging Het
Capn3 G A 2: 120,477,025 R15Q probably benign Het
Ccl3 A G 11: 83,649,213 F22S probably benign Het
Clcf1 T C 19: 4,222,096 F69S probably damaging Het
Col13a1 T C 10: 61,851,116 E170G probably damaging Het
Dhx29 T A 13: 112,946,879 F489L probably damaging Het
Dhx8 A T 11: 101,740,751 N390I probably damaging Het
Dkk1 T A 19: 30,548,789 Y135F probably benign Het
Edil3 G T 13: 89,319,713 V446F probably damaging Het
Epha5 T A 5: 84,331,866 E93V probably damaging Het
Epsti1 C T 14: 77,963,664 T196I possibly damaging Het
Fras1 T C 5: 96,728,535 S2376P possibly damaging Het
Frem2 A G 3: 53,652,490 V1532A probably benign Het
Fsip2 T A 2: 82,988,095 M4724K probably benign Het
Gcat T A 15: 79,043,073 L238Q probably damaging Het
Gimap6 T C 6: 48,702,275 K276E probably benign Het
Gjb5 T A 4: 127,355,929 I141F probably benign Het
Glt6d1 T C 2: 25,814,180 I7V probably benign Het
Gm37596 A G 3: 93,692,687 F125S probably benign Het
Gm5771 C T 6: 41,394,671 P17L probably benign Het
Gm6169 C A 13: 97,099,121 L39F probably damaging Het
Gtf2h5 G A 17: 6,084,524 G30R probably damaging Het
Herc6 C A 6: 57,618,684 T449K probably benign Het
Hpn A T 7: 31,099,262 Y132N probably damaging Het
Hpx A T 7: 105,595,148 M190K probably benign Het
Inf2 A G 12: 112,611,728 H1151R unknown Het
Krt74 A G 15: 101,760,579 noncoding transcript Het
Loxl3 G A 6: 83,049,882 S564N probably benign Het
Map7 T A 10: 20,267,359 V418E unknown Het
Mrpl37 T C 4: 107,064,391 N214D probably benign Het
Mthfr T C 4: 148,055,466 Y656H probably damaging Het
Myo9b A G 8: 71,359,882 D2099G probably benign Het
Nktr T A 9: 121,749,417 C825* probably null Het
Nomo1 A G 7: 46,076,157 E1029G probably benign Het
Nup133 T C 8: 123,906,281 D1037G probably benign Het
Olfr1271 A G 2: 90,265,615 F272L probably damaging Het
Olfr153 T C 2: 87,532,834 L267P probably benign Het
Pcdhb14 T A 18: 37,448,996 V385D possibly damaging Het
Pik3c2g T C 6: 139,737,007 L38P probably damaging Het
Pkd1 A T 17: 24,569,371 D701V probably damaging Het
Pnpla6 A G 8: 3,537,478 T1070A probably damaging Het
Ppl T C 16: 5,106,055 D185G probably benign Het
Prune1 A T 3: 95,258,178 L261Q probably damaging Het
Qser1 A T 2: 104,778,196 L1444I probably damaging Het
Serpina6 A C 12: 103,654,467 C8G probably damaging Het
Sla2 A T 2: 156,874,999 D180E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Thbs2 A T 17: 14,689,837 C167S probably damaging Het
Trak1 T A 9: 121,472,307 C710S possibly damaging Het
Tsks G A 7: 44,953,784 E337K probably damaging Het
Vcpip1 A G 1: 9,746,379 I593T probably damaging Het
Vmn2r118 A G 17: 55,592,765 I713T possibly damaging Het
Vmn2r23 C T 6: 123,713,074 T303M probably damaging Het
Vmn2r68 A T 7: 85,233,770 M258K probably benign Het
Vmn2r76 A G 7: 86,245,994 probably null Het
Wap A G 11: 6,638,609 I5T possibly damaging Het
Zfp235 A C 7: 24,142,151 H665P probably damaging Het
Other mutations in Tbx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Tbx3 APN 5 119682643 missense probably benign 0.45
IGL02174:Tbx3 APN 5 119675584 nonsense probably null
IGL02508:Tbx3 APN 5 119678812 missense possibly damaging 0.48
IGL03035:Tbx3 APN 5 119683096 utr 3 prime probably benign
R0047:Tbx3 UTSW 5 119680446 missense probably damaging 0.99
R0184:Tbx3 UTSW 5 119675562 missense probably damaging 1.00
R0365:Tbx3 UTSW 5 119675250 missense possibly damaging 0.81
R1209:Tbx3 UTSW 5 119680953 missense probably benign 0.19
R1956:Tbx3 UTSW 5 119680953 missense probably benign 0.19
R2231:Tbx3 UTSW 5 119677524 missense probably damaging 1.00
R4093:Tbx3 UTSW 5 119680748 missense probably benign
R4400:Tbx3 UTSW 5 119680571 missense probably damaging 0.99
R4578:Tbx3 UTSW 5 119682776 missense probably damaging 0.99
R4693:Tbx3 UTSW 5 119677570 missense possibly damaging 0.72
R4716:Tbx3 UTSW 5 119675670 missense possibly damaging 0.94
R4804:Tbx3 UTSW 5 119680512 missense possibly damaging 0.63
R5724:Tbx3 UTSW 5 119675603 missense possibly damaging 0.75
R5990:Tbx3 UTSW 5 119680529 missense probably benign 0.02
R6133:Tbx3 UTSW 5 119680953 missense probably benign 0.19
R6180:Tbx3 UTSW 5 119674067 missense probably damaging 1.00
R6429:Tbx3 UTSW 5 119674191 nonsense probably null
X0063:Tbx3 UTSW 5 119680881 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCTCCCAGTTAAACAGGC -3'
(R):5'- TAACTCCTAAAGCCTCGGGG -3'

Sequencing Primer
(F):5'- CCCAGGGTCAGAACATGTC -3'
(R):5'- CTCGGGGGCCAAGAAGC -3'
Posted On2016-11-09