Incidental Mutation 'R5664:Map7'
ID444277
Institutional Source Beutler Lab
Gene Symbol Map7
Ensembl Gene ENSMUSG00000019996
Gene Namemicrotubule-associated protein 7
SynonymsE-MAP-115, mste, ste, Mtap7, mshi
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R5664 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location20148471-20281590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20267359 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 418 (V418E)
Ref Sequence ENSEMBL: ENSMUSP00000111963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020173] [ENSMUST00000116259]
Predicted Effect unknown
Transcript: ENSMUST00000020173
AA Change: V410E
SMART Domains Protein: ENSMUSP00000020173
Gene: ENSMUSG00000019996
AA Change: V410E

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
low complexity region 55 85 N/A INTRINSIC
coiled coil region 89 152 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 379 392 N/A INTRINSIC
Pfam:MAP7 447 616 1.1e-59 PFAM
internal_repeat_1 623 658 5.23e-6 PROSPERO
internal_repeat_1 699 736 5.23e-6 PROSPERO
Predicted Effect unknown
Transcript: ENSMUST00000116259
AA Change: V418E
SMART Domains Protein: ENSMUSP00000111963
Gene: ENSMUSG00000019996
AA Change: V418E

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
low complexity region 55 85 N/A INTRINSIC
coiled coil region 89 152 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 379 392 N/A INTRINSIC
Pfam:MAP7 453 611 4.7e-46 PFAM
internal_repeat_1 623 656 2.41e-5 PROSPERO
internal_repeat_1 699 734 2.41e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217535
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a microtubule-associated protein that is predominantly expressed in cells of epithelial origin. Microtubule-associated proteins are thought to be involved in microtubule dynamics, which is essential for cell polarization and differentiation. This protein has been shown to be able to stabilize microtubules, and may serve to modulate microtubule functions. Studies of the related mouse protein also suggested an essential role in microtubule function required for spermatogenesis. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
PHENOTYPE: Males homozygous for mutations in this marker are sterile with small, disorganized testes, small epidiymis and seminiferous tubules. They have deformed spermatid nuclei and a block in spermatogenesis. Aberrant microtubules are seen in elongating spermatids and sertoli cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,994 probably null Het
1810032O08Rik A T 11: 116,672,664 T27S possibly damaging Het
4930432K21Rik A T 8: 84,166,659 I152F probably benign Het
9430015G10Rik T A 4: 156,123,559 L112H probably damaging Het
Acaca T C 11: 84,243,384 L441P probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arsj A T 3: 126,438,657 I351F probably damaging Het
Atp6v1b2 A G 8: 69,107,620 T373A probably damaging Het
Atr C A 9: 95,905,813 N1486K probably benign Het
Avl9 T C 6: 56,753,839 S583P probably damaging Het
Bptf A T 11: 107,073,699 D1493E probably benign Het
C2cd2l T C 9: 44,313,772 E548G probably damaging Het
Capn3 G A 2: 120,477,025 R15Q probably benign Het
Ccl3 A G 11: 83,649,213 F22S probably benign Het
Clcf1 T C 19: 4,222,096 F69S probably damaging Het
Col13a1 T C 10: 61,851,116 E170G probably damaging Het
Dhx29 T A 13: 112,946,879 F489L probably damaging Het
Dhx8 A T 11: 101,740,751 N390I probably damaging Het
Dkk1 T A 19: 30,548,789 Y135F probably benign Het
Edil3 G T 13: 89,319,713 V446F probably damaging Het
Epha5 T A 5: 84,331,866 E93V probably damaging Het
Epsti1 C T 14: 77,963,664 T196I possibly damaging Het
Fras1 T C 5: 96,728,535 S2376P possibly damaging Het
Frem2 A G 3: 53,652,490 V1532A probably benign Het
Fsip2 T A 2: 82,988,095 M4724K probably benign Het
Gcat T A 15: 79,043,073 L238Q probably damaging Het
Gimap6 T C 6: 48,702,275 K276E probably benign Het
Gjb5 T A 4: 127,355,929 I141F probably benign Het
Glt6d1 T C 2: 25,814,180 I7V probably benign Het
Gm37596 A G 3: 93,692,687 F125S probably benign Het
Gm5771 C T 6: 41,394,671 P17L probably benign Het
Gm6169 C A 13: 97,099,121 L39F probably damaging Het
Gtf2h5 G A 17: 6,084,524 G30R probably damaging Het
Herc6 C A 6: 57,618,684 T449K probably benign Het
Hpn A T 7: 31,099,262 Y132N probably damaging Het
Hpx A T 7: 105,595,148 M190K probably benign Het
Inf2 A G 12: 112,611,728 H1151R unknown Het
Krt74 A G 15: 101,760,579 noncoding transcript Het
Loxl3 G A 6: 83,049,882 S564N probably benign Het
Mrpl37 T C 4: 107,064,391 N214D probably benign Het
Mthfr T C 4: 148,055,466 Y656H probably damaging Het
Myo9b A G 8: 71,359,882 D2099G probably benign Het
Nktr T A 9: 121,749,417 C825* probably null Het
Nomo1 A G 7: 46,076,157 E1029G probably benign Het
Nup133 T C 8: 123,906,281 D1037G probably benign Het
Olfr1271 A G 2: 90,265,615 F272L probably damaging Het
Olfr153 T C 2: 87,532,834 L267P probably benign Het
Pcdhb14 T A 18: 37,448,996 V385D possibly damaging Het
Pik3c2g T C 6: 139,737,007 L38P probably damaging Het
Pkd1 A T 17: 24,569,371 D701V probably damaging Het
Pnpla6 A G 8: 3,537,478 T1070A probably damaging Het
Ppl T C 16: 5,106,055 D185G probably benign Het
Prune1 A T 3: 95,258,178 L261Q probably damaging Het
Qser1 A T 2: 104,778,196 L1444I probably damaging Het
Serpina6 A C 12: 103,654,467 C8G probably damaging Het
Sla2 A T 2: 156,874,999 D180E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Tbx3 A G 5: 119,678,731 K311R possibly damaging Het
Thbs2 A T 17: 14,689,837 C167S probably damaging Het
Trak1 T A 9: 121,472,307 C710S possibly damaging Het
Tsks G A 7: 44,953,784 E337K probably damaging Het
Vcpip1 A G 1: 9,746,379 I593T probably damaging Het
Vmn2r118 A G 17: 55,592,765 I713T possibly damaging Het
Vmn2r23 C T 6: 123,713,074 T303M probably damaging Het
Vmn2r68 A T 7: 85,233,770 M258K probably benign Het
Vmn2r76 A G 7: 86,245,994 probably null Het
Wap A G 11: 6,638,609 I5T possibly damaging Het
Zfp235 A C 7: 24,142,151 H665P probably damaging Het
Other mutations in Map7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Map7 APN 10 20273804 missense unknown
IGL03019:Map7 APN 10 20267355 missense unknown
IGL03263:Map7 APN 10 20245322 nonsense probably null
R0893:Map7 UTSW 10 20273883 splice site probably null
R1172:Map7 UTSW 10 20245299 missense probably damaging 1.00
R2097:Map7 UTSW 10 20246616 missense probably damaging 1.00
R2239:Map7 UTSW 10 20278282 missense unknown
R3760:Map7 UTSW 10 20276281 splice site probably benign
R3980:Map7 UTSW 10 20267353 missense unknown
R5009:Map7 UTSW 10 20261918 nonsense probably null
R5397:Map7 UTSW 10 20273321 missense unknown
R5422:Map7 UTSW 10 20266766 missense probably damaging 0.99
R5501:Map7 UTSW 10 20276202 missense unknown
R5773:Map7 UTSW 10 20246644 missense probably benign 0.22
R6209:Map7 UTSW 10 20276280 splice site probably null
R6438:Map7 UTSW 10 20267257 missense unknown
R6446:Map7 UTSW 10 20278233 missense unknown
X0022:Map7 UTSW 10 20269582 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGTCCATGCCTCATCTGC -3'
(R):5'- AGTGCTTTCATCCCTGAGC -3'

Sequencing Primer
(F):5'- ATGCCTCATCTGCCTGGTAC -3'
(R):5'- TAGTCTAATGTCAAGGCGCC -3'
Posted On2016-11-09