Incidental Mutation 'R5664:Ccl3'
ID444281
Institutional Source Beutler Lab
Gene Symbol Ccl3
Ensembl Gene ENSMUSG00000000982
Gene Namechemokine (C-C motif) ligand 3
SynonymsMIP-1alpha, MIP1-alpha, G0S19-1, LD78alpha, Mip1a, macrophage inflammatory protein-1alpha, Scya3, MIP-1 alpha, CCL3, MIP1-(a)
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5664 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location83647844-83649355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83649213 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 22 (F22S)
Ref Sequence ENSEMBL: ENSMUSP00000001008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001008] [ENSMUST00000182502]
Predicted Effect probably benign
Transcript: ENSMUST00000001008
AA Change: F22S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000001008
Gene: ENSMUSG00000000982
AA Change: F22S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SCY 31 88 2.25e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117199
Predicted Effect probably benign
Transcript: ENSMUST00000182502
SMART Domains Protein: ENSMUSP00000138342
Gene: ENSMUSG00000081906

DomainStartEndE-ValueType
Pfam:Ribosomal_L6 12 87 1.2e-16 PFAM
Pfam:Ribosomal_L6 119 177 6.8e-9 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of several cytokine genes that are clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins that function in inflammatory and immunoregulatory processes. The protein encoded by this gene binds to several chemokine receptors, including chemokine binding protein 2 and chemokine (C-C motif) receptor 5 (CCR5). CCR5 is a co-receptor for HIV, and binding of this protein to CCR5 inhibits HIV entry. The copy number of this gene varies among individuals, where most individuals have one to six copies, and a minority of individuals have zero or more than six copies. There are conflicting reports about copy number variation of this gene and its correlation to disease susceptibility.[provided by RefSeq, Apr 2014]
PHENOTYPE: Animals homozygous for a mutation in this gene exhibit resistance to Coxsackie virus-induced myocarditis and reduced pneumonitis following infection with influenza virus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,994 probably null Het
1810032O08Rik A T 11: 116,672,664 T27S possibly damaging Het
4930432K21Rik A T 8: 84,166,659 I152F probably benign Het
9430015G10Rik T A 4: 156,123,559 L112H probably damaging Het
Acaca T C 11: 84,243,384 L441P probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arsj A T 3: 126,438,657 I351F probably damaging Het
Atp6v1b2 A G 8: 69,107,620 T373A probably damaging Het
Atr C A 9: 95,905,813 N1486K probably benign Het
Avl9 T C 6: 56,753,839 S583P probably damaging Het
Bptf A T 11: 107,073,699 D1493E probably benign Het
C2cd2l T C 9: 44,313,772 E548G probably damaging Het
Capn3 G A 2: 120,477,025 R15Q probably benign Het
Clcf1 T C 19: 4,222,096 F69S probably damaging Het
Col13a1 T C 10: 61,851,116 E170G probably damaging Het
Dhx29 T A 13: 112,946,879 F489L probably damaging Het
Dhx8 A T 11: 101,740,751 N390I probably damaging Het
Dkk1 T A 19: 30,548,789 Y135F probably benign Het
Edil3 G T 13: 89,319,713 V446F probably damaging Het
Epha5 T A 5: 84,331,866 E93V probably damaging Het
Epsti1 C T 14: 77,963,664 T196I possibly damaging Het
Fras1 T C 5: 96,728,535 S2376P possibly damaging Het
Frem2 A G 3: 53,652,490 V1532A probably benign Het
Fsip2 T A 2: 82,988,095 M4724K probably benign Het
Gcat T A 15: 79,043,073 L238Q probably damaging Het
Gimap6 T C 6: 48,702,275 K276E probably benign Het
Gjb5 T A 4: 127,355,929 I141F probably benign Het
Glt6d1 T C 2: 25,814,180 I7V probably benign Het
Gm37596 A G 3: 93,692,687 F125S probably benign Het
Gm5771 C T 6: 41,394,671 P17L probably benign Het
Gm6169 C A 13: 97,099,121 L39F probably damaging Het
Gtf2h5 G A 17: 6,084,524 G30R probably damaging Het
Herc6 C A 6: 57,618,684 T449K probably benign Het
Hpn A T 7: 31,099,262 Y132N probably damaging Het
Hpx A T 7: 105,595,148 M190K probably benign Het
Inf2 A G 12: 112,611,728 H1151R unknown Het
Krt74 A G 15: 101,760,579 noncoding transcript Het
Loxl3 G A 6: 83,049,882 S564N probably benign Het
Map7 T A 10: 20,267,359 V418E unknown Het
Mrpl37 T C 4: 107,064,391 N214D probably benign Het
Mthfr T C 4: 148,055,466 Y656H probably damaging Het
Myo9b A G 8: 71,359,882 D2099G probably benign Het
Nktr T A 9: 121,749,417 C825* probably null Het
Nomo1 A G 7: 46,076,157 E1029G probably benign Het
Nup133 T C 8: 123,906,281 D1037G probably benign Het
Olfr1271 A G 2: 90,265,615 F272L probably damaging Het
Olfr153 T C 2: 87,532,834 L267P probably benign Het
Pcdhb14 T A 18: 37,448,996 V385D possibly damaging Het
Pik3c2g T C 6: 139,737,007 L38P probably damaging Het
Pkd1 A T 17: 24,569,371 D701V probably damaging Het
Pnpla6 A G 8: 3,537,478 T1070A probably damaging Het
Ppl T C 16: 5,106,055 D185G probably benign Het
Prune1 A T 3: 95,258,178 L261Q probably damaging Het
Qser1 A T 2: 104,778,196 L1444I probably damaging Het
Serpina6 A C 12: 103,654,467 C8G probably damaging Het
Sla2 A T 2: 156,874,999 D180E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Tbx3 A G 5: 119,678,731 K311R possibly damaging Het
Thbs2 A T 17: 14,689,837 C167S probably damaging Het
Trak1 T A 9: 121,472,307 C710S possibly damaging Het
Tsks G A 7: 44,953,784 E337K probably damaging Het
Vcpip1 A G 1: 9,746,379 I593T probably damaging Het
Vmn2r118 A G 17: 55,592,765 I713T possibly damaging Het
Vmn2r23 C T 6: 123,713,074 T303M probably damaging Het
Vmn2r68 A T 7: 85,233,770 M258K probably benign Het
Vmn2r76 A G 7: 86,245,994 probably null Het
Wap A G 11: 6,638,609 I5T possibly damaging Het
Zfp235 A C 7: 24,142,151 H665P probably damaging Het
Other mutations in Ccl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Ccl3 APN 11 83648641 missense possibly damaging 0.80
R0549:Ccl3 UTSW 11 83648336 missense probably damaging 1.00
R4583:Ccl3 UTSW 11 83648338 missense probably benign 0.06
R5713:Ccl3 UTSW 11 83649240 missense possibly damaging 0.87
R6680:Ccl3 UTSW 11 83648306 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGCTGGCTAGTAAGTACATG -3'
(R):5'- GAAGGGGCATATGGCTTCAG -3'

Sequencing Primer
(F):5'- GCTGGCTAGTAAGTACATGACAACAC -3'
(R):5'- GGCATATGGCTTCAGACACCAG -3'
Posted On2016-11-09