Incidental Mutation 'R5664:Edil3'
ID444289
Institutional Source Beutler Lab
Gene Symbol Edil3
Ensembl Gene ENSMUSG00000034488
Gene NameEGF-like repeats and discoidin I-like domains 3
SynonymsDel-1, developmental endothelial locus-1, Del1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5664 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location88821472-89323223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89319713 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 446 (V446F)
Ref Sequence ENSEMBL: ENSMUSP00000080462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043111] [ENSMUST00000081769]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043111
AA Change: V436F

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044652
Gene: ENSMUSG00000034488
AA Change: V436F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 60 2.03e-6 SMART
EGF 67 107 1.62e-5 SMART
EGF_CA 109 145 4.32e-10 SMART
FA58C 147 304 3.7e-58 SMART
FA58C 308 466 1.44e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081769
AA Change: V446F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080462
Gene: ENSMUSG00000034488
AA Change: V446F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 60 2.03e-6 SMART
EGF 77 117 1.62e-5 SMART
EGF_CA 119 155 4.32e-10 SMART
FA58C 157 314 3.7e-58 SMART
FA58C 318 476 1.44e-37 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integrin ligand. It plays an important role in mediating angiogenesis and may be important in vessel wall remodeling and development. It also influences endothelial cell behavior. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no noticeable fur phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,994 probably null Het
1810032O08Rik A T 11: 116,672,664 T27S possibly damaging Het
4930432K21Rik A T 8: 84,166,659 I152F probably benign Het
9430015G10Rik T A 4: 156,123,559 L112H probably damaging Het
Acaca T C 11: 84,243,384 L441P probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arsj A T 3: 126,438,657 I351F probably damaging Het
Atp6v1b2 A G 8: 69,107,620 T373A probably damaging Het
Atr C A 9: 95,905,813 N1486K probably benign Het
Avl9 T C 6: 56,753,839 S583P probably damaging Het
Bptf A T 11: 107,073,699 D1493E probably benign Het
C2cd2l T C 9: 44,313,772 E548G probably damaging Het
Capn3 G A 2: 120,477,025 R15Q probably benign Het
Ccl3 A G 11: 83,649,213 F22S probably benign Het
Clcf1 T C 19: 4,222,096 F69S probably damaging Het
Col13a1 T C 10: 61,851,116 E170G probably damaging Het
Dhx29 T A 13: 112,946,879 F489L probably damaging Het
Dhx8 A T 11: 101,740,751 N390I probably damaging Het
Dkk1 T A 19: 30,548,789 Y135F probably benign Het
Epha5 T A 5: 84,331,866 E93V probably damaging Het
Epsti1 C T 14: 77,963,664 T196I possibly damaging Het
Fras1 T C 5: 96,728,535 S2376P possibly damaging Het
Frem2 A G 3: 53,652,490 V1532A probably benign Het
Fsip2 T A 2: 82,988,095 M4724K probably benign Het
Gcat T A 15: 79,043,073 L238Q probably damaging Het
Gimap6 T C 6: 48,702,275 K276E probably benign Het
Gjb5 T A 4: 127,355,929 I141F probably benign Het
Glt6d1 T C 2: 25,814,180 I7V probably benign Het
Gm37596 A G 3: 93,692,687 F125S probably benign Het
Gm5771 C T 6: 41,394,671 P17L probably benign Het
Gm6169 C A 13: 97,099,121 L39F probably damaging Het
Gtf2h5 G A 17: 6,084,524 G30R probably damaging Het
Herc6 C A 6: 57,618,684 T449K probably benign Het
Hpn A T 7: 31,099,262 Y132N probably damaging Het
Hpx A T 7: 105,595,148 M190K probably benign Het
Inf2 A G 12: 112,611,728 H1151R unknown Het
Krt74 A G 15: 101,760,579 noncoding transcript Het
Loxl3 G A 6: 83,049,882 S564N probably benign Het
Map7 T A 10: 20,267,359 V418E unknown Het
Mrpl37 T C 4: 107,064,391 N214D probably benign Het
Mthfr T C 4: 148,055,466 Y656H probably damaging Het
Myo9b A G 8: 71,359,882 D2099G probably benign Het
Nktr T A 9: 121,749,417 C825* probably null Het
Nomo1 A G 7: 46,076,157 E1029G probably benign Het
Nup133 T C 8: 123,906,281 D1037G probably benign Het
Olfr1271 A G 2: 90,265,615 F272L probably damaging Het
Olfr153 T C 2: 87,532,834 L267P probably benign Het
Pcdhb14 T A 18: 37,448,996 V385D possibly damaging Het
Pik3c2g T C 6: 139,737,007 L38P probably damaging Het
Pkd1 A T 17: 24,569,371 D701V probably damaging Het
Pnpla6 A G 8: 3,537,478 T1070A probably damaging Het
Ppl T C 16: 5,106,055 D185G probably benign Het
Prune1 A T 3: 95,258,178 L261Q probably damaging Het
Qser1 A T 2: 104,778,196 L1444I probably damaging Het
Serpina6 A C 12: 103,654,467 C8G probably damaging Het
Sla2 A T 2: 156,874,999 D180E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Tbx3 A G 5: 119,678,731 K311R possibly damaging Het
Thbs2 A T 17: 14,689,837 C167S probably damaging Het
Trak1 T A 9: 121,472,307 C710S possibly damaging Het
Tsks G A 7: 44,953,784 E337K probably damaging Het
Vcpip1 A G 1: 9,746,379 I593T probably damaging Het
Vmn2r118 A G 17: 55,592,765 I713T possibly damaging Het
Vmn2r23 C T 6: 123,713,074 T303M probably damaging Het
Vmn2r68 A T 7: 85,233,770 M258K probably benign Het
Vmn2r76 A G 7: 86,245,994 probably null Het
Wap A G 11: 6,638,609 I5T possibly damaging Het
Zfp235 A C 7: 24,142,151 H665P probably damaging Het
Other mutations in Edil3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Edil3 APN 13 89289533 missense probably benign 0.40
IGL01628:Edil3 APN 13 89319826 utr 3 prime probably benign
IGL02112:Edil3 APN 13 89180255 missense probably damaging 1.00
IGL03123:Edil3 APN 13 89131736 missense probably damaging 1.00
R0402:Edil3 UTSW 13 89199451 splice site probably benign
R0608:Edil3 UTSW 13 89184849 missense probably damaging 1.00
R0675:Edil3 UTSW 13 89177280 missense probably damaging 0.96
R0735:Edil3 UTSW 13 89177178 missense probably damaging 0.97
R0991:Edil3 UTSW 13 89289506 nonsense probably null
R1507:Edil3 UTSW 13 89131712 missense probably damaging 1.00
R1643:Edil3 UTSW 13 89289576 critical splice donor site probably null
R2008:Edil3 UTSW 13 88944953 splice site probably null
R3703:Edil3 UTSW 13 89177298 missense probably benign 0.01
R4206:Edil3 UTSW 13 89180278 missense probably damaging 1.00
R4258:Edil3 UTSW 13 89177153 missense probably damaging 1.00
R4570:Edil3 UTSW 13 89131897 intron probably benign
R4575:Edil3 UTSW 13 89319731 missense probably damaging 1.00
R4576:Edil3 UTSW 13 89319731 missense probably damaging 1.00
R4654:Edil3 UTSW 13 89289470 missense probably damaging 1.00
R5420:Edil3 UTSW 13 89131772 missense probably damaging 1.00
R5446:Edil3 UTSW 13 89184838 missense possibly damaging 0.65
R5534:Edil3 UTSW 13 89199474 missense probably benign 0.00
R5653:Edil3 UTSW 13 89131812 missense probably damaging 1.00
R5663:Edil3 UTSW 13 89042508 missense probably damaging 0.99
R6179:Edil3 UTSW 13 88821989 missense probably benign
R6254:Edil3 UTSW 13 89319729 missense probably damaging 1.00
R6813:Edil3 UTSW 13 89289456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCCTCAAACATCCATGCCTTTG -3'
(R):5'- CACACAGTTCATTTCGTGGAG -3'

Sequencing Primer
(F):5'- TCAAACATCCATGCCTTTGTATAC -3'
(R):5'- GTTCATTTCGTGGAGATACTTATAGG -3'
Posted On2016-11-09