Incidental Mutation 'R5664:Pkd1'
ID444299
Institutional Source Beutler Lab
Gene Symbol Pkd1
Ensembl Gene ENSMUSG00000032855
Gene Namepolycystin 1, transient receptor poteintial channel interacting
SynonymsPC-1, polycystin-1, PC1
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_013630.2; MGI:97603

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5664 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24549834-24596508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24569371 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 701 (D701V)
Ref Sequence ENSEMBL: ENSMUSP00000049296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035565] [ENSMUST00000228745]
Predicted Effect probably damaging
Transcript: ENSMUST00000035565
AA Change: D701V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049296
Gene: ENSMUSG00000032855
AA Change: D701V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LRRNT 32 71 1.61e-8 SMART
LRR_TYP 90 113 2.47e-5 SMART
LRRCT 125 177 3.84e-12 SMART
WSC 177 271 6.93e-34 SMART
PKD 272 355 2.72e-15 SMART
CLECT 406 530 5.72e-20 SMART
low complexity region 545 558 N/A INTRINSIC
low complexity region 763 788 N/A INTRINSIC
PKD 930 1008 1.06e-8 SMART
PKD 1015 1119 2.26e-12 SMART
PKD 1122 1205 2.03e-14 SMART
PKD 1208 1288 1.14e-17 SMART
PKD 1290 1373 2.35e-10 SMART
PKD 1374 1459 7.63e-10 SMART
PKD 1464 1541 1.95e-16 SMART
PKD 1544 1625 1.05e-16 SMART
PKD 1631 1714 1.93e-1 SMART
PKD 1716 1798 2.21e-15 SMART
PKD 1799 1882 5.7e-9 SMART
PKD 1884 1964 1.56e-6 SMART
PKD 1968 2056 3.1e-10 SMART
PKD 2057 2140 1.74e-13 SMART
Pfam:REJ 2167 2610 1e-108 PFAM
low complexity region 2697 2706 N/A INTRINSIC
GPS 3003 3052 1.33e-12 SMART
transmembrane domain 3065 3087 N/A INTRINSIC
LH2 3110 3224 3.5e-18 SMART
transmembrane domain 3275 3294 N/A INTRINSIC
transmembrane domain 3314 3336 N/A INTRINSIC
low complexity region 3357 3378 N/A INTRINSIC
low complexity region 3479 3492 N/A INTRINSIC
transmembrane domain 3547 3569 N/A INTRINSIC
low complexity region 3573 3591 N/A INTRINSIC
low complexity region 3626 3639 N/A INTRINSIC
low complexity region 3661 3676 N/A INTRINSIC
Pfam:PKD_channel 3701 4103 7.1e-125 PFAM
low complexity region 4153 4172 N/A INTRINSIC
low complexity region 4238 4256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228745
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype Strain: Several; see below
Lethality: E13-E15
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutant embryos begin to die after embryonic day (E) 14.5. They develop edema by E13.5, pancreatic cysts by E15.5 and kidney cysts by E16.5. Heterozygous adults develop cysts of the kidneys (~20-30%) and the liver (~10%) late in life. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted(28) Gene trapped(3) Chemically induced(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,994 probably null Het
1810032O08Rik A T 11: 116,672,664 T27S possibly damaging Het
4930432K21Rik A T 8: 84,166,659 I152F probably benign Het
9430015G10Rik T A 4: 156,123,559 L112H probably damaging Het
Acaca T C 11: 84,243,384 L441P probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arsj A T 3: 126,438,657 I351F probably damaging Het
Atp6v1b2 A G 8: 69,107,620 T373A probably damaging Het
Atr C A 9: 95,905,813 N1486K probably benign Het
Avl9 T C 6: 56,753,839 S583P probably damaging Het
Bptf A T 11: 107,073,699 D1493E probably benign Het
C2cd2l T C 9: 44,313,772 E548G probably damaging Het
Capn3 G A 2: 120,477,025 R15Q probably benign Het
Ccl3 A G 11: 83,649,213 F22S probably benign Het
Clcf1 T C 19: 4,222,096 F69S probably damaging Het
Col13a1 T C 10: 61,851,116 E170G probably damaging Het
Dhx29 T A 13: 112,946,879 F489L probably damaging Het
Dhx8 A T 11: 101,740,751 N390I probably damaging Het
Dkk1 T A 19: 30,548,789 Y135F probably benign Het
Edil3 G T 13: 89,319,713 V446F probably damaging Het
Epha5 T A 5: 84,331,866 E93V probably damaging Het
Epsti1 C T 14: 77,963,664 T196I possibly damaging Het
Fras1 T C 5: 96,728,535 S2376P possibly damaging Het
Frem2 A G 3: 53,652,490 V1532A probably benign Het
Fsip2 T A 2: 82,988,095 M4724K probably benign Het
Gcat T A 15: 79,043,073 L238Q probably damaging Het
Gimap6 T C 6: 48,702,275 K276E probably benign Het
Gjb5 T A 4: 127,355,929 I141F probably benign Het
Glt6d1 T C 2: 25,814,180 I7V probably benign Het
Gm37596 A G 3: 93,692,687 F125S probably benign Het
Gm5771 C T 6: 41,394,671 P17L probably benign Het
Gm6169 C A 13: 97,099,121 L39F probably damaging Het
Gtf2h5 G A 17: 6,084,524 G30R probably damaging Het
Herc6 C A 6: 57,618,684 T449K probably benign Het
Hpn A T 7: 31,099,262 Y132N probably damaging Het
Hpx A T 7: 105,595,148 M190K probably benign Het
Inf2 A G 12: 112,611,728 H1151R unknown Het
Krt74 A G 15: 101,760,579 noncoding transcript Het
Loxl3 G A 6: 83,049,882 S564N probably benign Het
Map7 T A 10: 20,267,359 V418E unknown Het
Mrpl37 T C 4: 107,064,391 N214D probably benign Het
Mthfr T C 4: 148,055,466 Y656H probably damaging Het
Myo9b A G 8: 71,359,882 D2099G probably benign Het
Nktr T A 9: 121,749,417 C825* probably null Het
Nomo1 A G 7: 46,076,157 E1029G probably benign Het
Nup133 T C 8: 123,906,281 D1037G probably benign Het
Olfr1271 A G 2: 90,265,615 F272L probably damaging Het
Olfr153 T C 2: 87,532,834 L267P probably benign Het
Pcdhb14 T A 18: 37,448,996 V385D possibly damaging Het
Pik3c2g T C 6: 139,737,007 L38P probably damaging Het
Pnpla6 A G 8: 3,537,478 T1070A probably damaging Het
Ppl T C 16: 5,106,055 D185G probably benign Het
Prune1 A T 3: 95,258,178 L261Q probably damaging Het
Qser1 A T 2: 104,778,196 L1444I probably damaging Het
Serpina6 A C 12: 103,654,467 C8G probably damaging Het
Sla2 A T 2: 156,874,999 D180E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Tbx3 A G 5: 119,678,731 K311R possibly damaging Het
Thbs2 A T 17: 14,689,837 C167S probably damaging Het
Trak1 T A 9: 121,472,307 C710S possibly damaging Het
Tsks G A 7: 44,953,784 E337K probably damaging Het
Vcpip1 A G 1: 9,746,379 I593T probably damaging Het
Vmn2r118 A G 17: 55,592,765 I713T possibly damaging Het
Vmn2r23 C T 6: 123,713,074 T303M probably damaging Het
Vmn2r68 A T 7: 85,233,770 M258K probably benign Het
Vmn2r76 A G 7: 86,245,994 probably null Het
Wap A G 11: 6,638,609 I5T possibly damaging Het
Zfp235 A C 7: 24,142,151 H665P probably damaging Het
Other mutations in Pkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pkd1 APN 17 24580095 missense probably damaging 1.00
IGL00503:Pkd1 APN 17 24565427 missense probably benign
IGL00549:Pkd1 APN 17 24572761 missense probably benign
IGL00573:Pkd1 APN 17 24594530 nonsense probably null
IGL00924:Pkd1 APN 17 24571627 nonsense probably null
IGL01319:Pkd1 APN 17 24587919 unclassified probably benign
IGL01326:Pkd1 APN 17 24576174 nonsense probably null
IGL01457:Pkd1 APN 17 24594821 unclassified probably null
IGL01541:Pkd1 APN 17 24586298 missense probably damaging 1.00
IGL01575:Pkd1 APN 17 24573128 missense probably damaging 1.00
IGL01606:Pkd1 APN 17 24576523 missense probably damaging 0.97
IGL01642:Pkd1 APN 17 24581292 missense probably damaging 1.00
IGL01888:Pkd1 APN 17 24585815 missense possibly damaging 0.91
IGL01940:Pkd1 APN 17 24579746 missense possibly damaging 0.63
IGL01958:Pkd1 APN 17 24580324 missense probably damaging 1.00
IGL02005:Pkd1 APN 17 24586004 missense possibly damaging 0.67
IGL02121:Pkd1 APN 17 24575927 missense probably benign 0.03
IGL02148:Pkd1 APN 17 24579836 missense probably damaging 1.00
IGL02409:Pkd1 APN 17 24573623 missense probably benign 0.01
IGL02442:Pkd1 APN 17 24565226 missense probably benign 0.41
IGL02498:Pkd1 APN 17 24585779 missense possibly damaging 0.91
IGL02501:Pkd1 APN 17 24569699 missense probably benign 0.01
IGL02551:Pkd1 APN 17 24573815 missense probably damaging 1.00
IGL02635:Pkd1 APN 17 24572811 missense probably damaging 1.00
IGL02673:Pkd1 APN 17 24571283 missense probably benign 0.40
IGL02808:Pkd1 APN 17 24593504 missense probably damaging 1.00
IGL02816:Pkd1 APN 17 24594515 missense probably benign 0.00
IGL02863:Pkd1 APN 17 24569752 missense possibly damaging 0.56
IGL02927:Pkd1 APN 17 24575189 missense probably damaging 1.00
IGL02961:Pkd1 APN 17 24578115 missense possibly damaging 0.81
IGL03003:Pkd1 APN 17 24593603 critical splice donor site probably null
IGL03066:Pkd1 APN 17 24586234 missense probably damaging 1.00
IGL03182:Pkd1 APN 17 24573818 missense probably damaging 0.98
IGL03384:Pkd1 APN 17 24565897 missense probably benign 0.00
IGL03404:Pkd1 APN 17 24564406 missense probably damaging 0.97
PIT1430001:Pkd1 UTSW 17 24569511 missense probably damaging 0.99
R0017:Pkd1 UTSW 17 24578539 critical splice donor site probably null
R0017:Pkd1 UTSW 17 24578539 critical splice donor site probably null
R0022:Pkd1 UTSW 17 24594819 missense probably damaging 0.98
R0022:Pkd1 UTSW 17 24594819 missense probably damaging 0.98
R0058:Pkd1 UTSW 17 24564703 missense probably benign 0.06
R0058:Pkd1 UTSW 17 24564703 missense probably benign 0.06
R0085:Pkd1 UTSW 17 24586223 missense probably damaging 0.98
R0094:Pkd1 UTSW 17 24581276 missense possibly damaging 0.80
R0094:Pkd1 UTSW 17 24581276 missense possibly damaging 0.80
R0135:Pkd1 UTSW 17 24565071 missense possibly damaging 0.85
R0304:Pkd1 UTSW 17 24585946 missense probably damaging 1.00
R0427:Pkd1 UTSW 17 24593502 missense probably damaging 0.98
R0502:Pkd1 UTSW 17 24574792 missense probably damaging 0.99
R0518:Pkd1 UTSW 17 24595219 missense probably benign 0.01
R0521:Pkd1 UTSW 17 24595219 missense probably benign 0.01
R0544:Pkd1 UTSW 17 24585683 missense probably damaging 1.00
R0546:Pkd1 UTSW 17 24580138 missense probably benign 0.44
R0626:Pkd1 UTSW 17 24575575 missense probably damaging 0.96
R0648:Pkd1 UTSW 17 24594937 missense probably damaging 1.00
R1138:Pkd1 UTSW 17 24586032 missense probably damaging 1.00
R1302:Pkd1 UTSW 17 24568236 missense probably benign 0.00
R1306:Pkd1 UTSW 17 24573172 missense probably damaging 0.97
R1349:Pkd1 UTSW 17 24575266 missense probably damaging 1.00
R1372:Pkd1 UTSW 17 24575266 missense probably damaging 1.00
R1437:Pkd1 UTSW 17 24595132 missense probably damaging 1.00
R1515:Pkd1 UTSW 17 24594853 missense probably benign 0.01
R1605:Pkd1 UTSW 17 24577526 missense possibly damaging 0.95
R1622:Pkd1 UTSW 17 24581640 missense probably benign
R1623:Pkd1 UTSW 17 24578269 missense probably damaging 0.99
R1726:Pkd1 UTSW 17 24564176 missense probably damaging 0.96
R1756:Pkd1 UTSW 17 24594485 missense probably damaging 1.00
R1780:Pkd1 UTSW 17 24581569 missense probably benign
R1785:Pkd1 UTSW 17 24591099 missense probably benign 0.00
R1829:Pkd1 UTSW 17 24565584 missense probably benign
R1869:Pkd1 UTSW 17 24594931 missense probably damaging 1.00
R1920:Pkd1 UTSW 17 24595157 missense probably damaging 0.99
R1922:Pkd1 UTSW 17 24595157 missense probably damaging 0.99
R1987:Pkd1 UTSW 17 24576592 splice site probably null
R1988:Pkd1 UTSW 17 24576592 splice site probably null
R1998:Pkd1 UTSW 17 24573014 missense probably damaging 1.00
R2007:Pkd1 UTSW 17 24579785 missense probably damaging 1.00
R2019:Pkd1 UTSW 17 24568684 nonsense probably null
R2054:Pkd1 UTSW 17 24574796 missense probably benign 0.00
R2061:Pkd1 UTSW 17 24569914 missense possibly damaging 0.89
R2196:Pkd1 UTSW 17 24580072 missense possibly damaging 0.60
R2203:Pkd1 UTSW 17 24580889 missense probably benign 0.01
R2301:Pkd1 UTSW 17 24574612 missense probably benign
R2655:Pkd1 UTSW 17 24576490 missense probably damaging 0.99
R2860:Pkd1 UTSW 17 24565446 missense probably benign 0.43
R2861:Pkd1 UTSW 17 24565446 missense probably benign 0.43
R3000:Pkd1 UTSW 17 24594486 missense probably damaging 1.00
R3150:Pkd1 UTSW 17 24579791 missense probably benign 0.00
R3747:Pkd1 UTSW 17 24591461 missense possibly damaging 0.67
R3812:Pkd1 UTSW 17 24565641 missense probably benign 0.00
R3859:Pkd1 UTSW 17 24578092 splice site probably benign
R3893:Pkd1 UTSW 17 24572110 critical splice donor site probably null
R3947:Pkd1 UTSW 17 24578037 splice site probably benign
R3949:Pkd1 UTSW 17 24578037 splice site probably benign
R4176:Pkd1 UTSW 17 24587997 missense probably benign 0.17
R4199:Pkd1 UTSW 17 24570030 missense probably benign 0.41
R4225:Pkd1 UTSW 17 24593523 missense possibly damaging 0.50
R4439:Pkd1 UTSW 17 24585692 missense probably damaging 1.00
R4476:Pkd1 UTSW 17 24576526 missense probably damaging 1.00
R4716:Pkd1 UTSW 17 24576133 missense probably damaging 1.00
R4801:Pkd1 UTSW 17 24578096 missense probably damaging 1.00
R4802:Pkd1 UTSW 17 24578096 missense probably damaging 1.00
R4817:Pkd1 UTSW 17 24565374 unclassified probably null
R4903:Pkd1 UTSW 17 24572002 missense probably benign 0.30
R4910:Pkd1 UTSW 17 24572687 missense probably damaging 1.00
R4964:Pkd1 UTSW 17 24586068 critical splice donor site probably null
R4966:Pkd1 UTSW 17 24586068 critical splice donor site probably null
R5040:Pkd1 UTSW 17 24571260 missense probably benign 0.02
R5042:Pkd1 UTSW 17 24569887 missense probably benign 0.00
R5088:Pkd1 UTSW 17 24590838 missense possibly damaging 0.94
R5121:Pkd1 UTSW 17 24573463 missense probably benign
R5296:Pkd1 UTSW 17 24576074 missense probably damaging 1.00
R5338:Pkd1 UTSW 17 24594536 missense probably benign
R5356:Pkd1 UTSW 17 24593577 missense probably damaging 0.97
R5357:Pkd1 UTSW 17 24565790 missense probably damaging 1.00
R5363:Pkd1 UTSW 17 24565073 missense probably benign
R5383:Pkd1 UTSW 17 24574375 missense probably benign
R5622:Pkd1 UTSW 17 24574040 missense possibly damaging 0.67
R5651:Pkd1 UTSW 17 24591387 missense possibly damaging 0.88
R5723:Pkd1 UTSW 17 24565523 missense probably benign 0.01
R5797:Pkd1 UTSW 17 24592641 missense possibly damaging 0.55
R5838:Pkd1 UTSW 17 24580212 missense possibly damaging 0.75
R5866:Pkd1 UTSW 17 24580961 missense probably damaging 0.99
R5873:Pkd1 UTSW 17 24569830 missense probably benign
R5906:Pkd1 UTSW 17 24572920 missense probably benign 0.16
R6047:Pkd1 UTSW 17 24595085 missense probably damaging 1.00
R6076:Pkd1 UTSW 17 24581030 missense probably benign 0.14
R6151:Pkd1 UTSW 17 24575606 missense probably benign 0.00
R6252:Pkd1 UTSW 17 24581226 missense probably damaging 0.98
R6341:Pkd1 UTSW 17 24580227 missense probably damaging 1.00
R6540:Pkd1 UTSW 17 24575977 missense probably damaging 1.00
R6732:Pkd1 UTSW 17 24569413 missense probably damaging 1.00
R6836:Pkd1 UTSW 17 24581259 missense probably damaging 1.00
R6856:Pkd1 UTSW 17 24573493 missense probably benign 0.05
R6865:Pkd1 UTSW 17 24576487 missense probably benign 0.43
X0024:Pkd1 UTSW 17 24591392 missense possibly damaging 0.68
X0061:Pkd1 UTSW 17 24594931 missense probably damaging 1.00
X0065:Pkd1 UTSW 17 24586164 missense probably benign 0.19
Z1088:Pkd1 UTSW 17 24565605 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GTGCATGTCCCCTATATTACAATGTC -3'
(R):5'- GCTCTGTGACCAAAAGCAGC -3'

Sequencing Primer
(F):5'- AATGTCCTGTTTGACTCAGCCATG -3'
(R):5'- CTCTGTGACCAAAAGCAGCTGTAG -3'
Posted On2016-11-09