Incidental Mutation 'R5665:Col6a3'
ID444305
Institutional Source Beutler Lab
Gene Symbol Col6a3
Ensembl Gene ENSMUSG00000048126
Gene Namecollagen, type VI, alpha 3
SynonymsCol6a-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5665 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location90765923-90843971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90827880 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 229 (E229G)
Ref Sequence ENSEMBL: ENSMUSP00000115210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056925] [ENSMUST00000097653] [ENSMUST00000130846] [ENSMUST00000187753] [ENSMUST00000188587]
Predicted Effect probably benign
Transcript: ENSMUST00000056925
AA Change: E229G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000057131
Gene: ENSMUSG00000048126
AA Change: E229G

DomainStartEndE-ValueType
VWA 36 214 3.58e-42 SMART
VWA 239 415 3.34e-42 SMART
VWA 442 617 7.27e-43 SMART
VWA 636 813 7.8e-43 SMART
VWA 834 1010 4.21e-39 SMART
VWA 1024 1203 3.02e-40 SMART
VWA 1228 1406 1.1e-42 SMART
VWA 1431 1604 9.17e-40 SMART
VWA 1634 1807 1.78e-37 SMART
VWA 1833 2022 7.92e-3 SMART
Pfam:Collagen 2033 2094 2e-10 PFAM
Pfam:Collagen 2077 2142 2.8e-10 PFAM
low complexity region 2179 2222 N/A INTRINSIC
low complexity region 2228 2279 N/A INTRINSIC
Pfam:Collagen 2311 2373 7.9e-11 PFAM
VWA 2397 2576 3.95e-21 SMART
VWA 2614 2813 2.25e-25 SMART
low complexity region 2864 2880 N/A INTRINSIC
low complexity region 2886 2900 N/A INTRINSIC
low complexity region 2903 2941 N/A INTRINSIC
low complexity region 2945 3024 N/A INTRINSIC
low complexity region 3039 3076 N/A INTRINSIC
low complexity region 3091 3103 N/A INTRINSIC
FN3 3104 3183 4.6e-1 SMART
KU 3226 3279 4.34e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097653
SMART Domains Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126

DomainStartEndE-ValueType
VWA 35 210 7.27e-43 SMART
VWA 227 403 4.21e-39 SMART
VWA 417 596 3.02e-40 SMART
VWA 621 799 1.1e-42 SMART
VWA 824 997 9.17e-40 SMART
VWA 1027 1200 1.78e-37 SMART
VWA 1226 1415 7.92e-3 SMART
Pfam:Collagen 1426 1486 9.2e-10 PFAM
Pfam:Collagen 1473 1539 2.2e-9 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 3.95e-21 SMART
VWA 2007 2206 2.25e-25 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 4.6e-1 SMART
KU 2619 2672 4.34e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130846
AA Change: E229G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115210
Gene: ENSMUSG00000048126
AA Change: E229G

DomainStartEndE-ValueType
VWA 36 214 3.58e-42 SMART
VWA 239 415 3.34e-42 SMART
VWA 442 617 7.27e-43 SMART
VWA 636 813 7.8e-43 SMART
VWA 834 1010 4.21e-39 SMART
VWA 1024 1203 3.02e-40 SMART
VWA 1228 1406 1.1e-42 SMART
VWA 1431 1604 9.17e-40 SMART
Pfam:VWA 1636 1703 1.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187753
SMART Domains Protein: ENSMUSP00000140280
Gene: ENSMUSG00000048126

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:VWA 35 74 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188587
SMART Domains Protein: ENSMUSP00000140858
Gene: ENSMUSG00000048126

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWA 35 210 4.7e-45 SMART
VWA 227 403 2.7e-41 SMART
VWA 417 596 2e-42 SMART
VWA 621 799 7e-45 SMART
VWA 824 997 5.8e-42 SMART
VWA 1027 1200 1.1e-39 SMART
VWA 1226 1415 4.8e-5 SMART
Pfam:Collagen 1426 1486 3.8e-8 PFAM
Pfam:Collagen 1473 1539 9.1e-8 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 2.4e-23 SMART
VWA 2007 2206 1.4e-27 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 2.2e-3 SMART
KU 2619 2672 2.1e-26 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-3 chain, one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The alpha-3 chain of type VI collagen is much larger than the alpha-1 and -2 chains. This difference in size is largely due to an increase in the number of subdomains, similar to von Willebrand Factor type A domains, that are found in the amino terminal globular domain of all the alpha chains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in the type VI collagen genes are associated with Bethlem myopathy, a rare autosomal dominant proximal myopathy with early childhood onset. Mutations in this gene are also a cause of Ullrich congenital muscular dystrophy, also referred to as Ullrich scleroatonic muscular dystrophy, an autosomal recessive congenital myopathy that is more severe than Bethlem myopathy. Multiple transcript variants have been identified, but the full-length nature of only some of these variants has been described. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit mild myopathy, decreased skeletal muscle weight, increased collagen deposition in muscles, skeletal muscle interstitial fibrosis and abnormal tendon collagen fibril morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acaca G T 11: 84,245,294 E492* probably null Het
Acp7 T A 7: 28,616,543 K206M probably benign Het
Agbl1 T A 7: 76,589,503 F584I probably damaging Het
Ahi1 A G 10: 21,055,047 I929V possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arhgef40 A G 14: 52,000,900 I1279V possibly damaging Het
Arl14 A C 3: 69,223,038 T173P probably damaging Het
Asap1 A G 15: 64,312,453 S44P probably damaging Het
Btbd7 C A 12: 102,785,197 A1103S probably benign Het
Capn10 T A 1: 92,937,931 probably null Het
Capn7 T C 14: 31,369,802 F719L probably benign Het
Casp7 G A 19: 56,440,982 D267N probably benign Het
Ccdc13 C A 9: 121,814,290 K348N probably damaging Het
Chchd1 T C 14: 20,703,110 F13L probably benign Het
Clcn6 T A 4: 148,014,561 M442L possibly damaging Het
Cyb5r3 A G 15: 83,154,554 F278S probably damaging Het
Dhx16 C T 17: 35,891,086 Q1002* probably null Het
Dppa4 T C 16: 48,291,015 L121P probably benign Het
Dpyd A G 3: 118,917,092 E383G probably damaging Het
Eif4g3 A G 4: 138,126,589 T489A probably benign Het
Elovl1 G T 4: 118,431,635 V174L probably damaging Het
Elp3 T C 14: 65,551,402 K392E possibly damaging Het
Fancd2os C A 6: 113,598,024 W7L probably damaging Het
Fchsd2 A G 7: 101,110,784 T23A possibly damaging Het
Gabrp C G 11: 33,554,308 A336P possibly damaging Het
Gcm2 T A 13: 41,109,911 Y15F possibly damaging Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Herc1 A G 9: 66,465,435 E3091G probably damaging Het
Homer1 A T 13: 93,356,102 M184L probably benign Het
Izumo1r T C 9: 14,900,849 E117G probably damaging Het
Kcnt1 C T 2: 25,901,909 Q590* probably null Het
Lama1 G T 17: 67,770,987 C1139F probably damaging Het
Med29 C T 7: 28,386,814 A190T probably benign Het
Mgea5 A C 19: 45,776,997 S124A probably benign Het
Muc4 T C 16: 32,750,782 V220A probably benign Het
Mxra8 G T 4: 155,842,921 V388L probably benign Het
Myo5a T C 9: 75,144,181 probably null Het
Myrip A G 9: 120,461,433 Y706C probably damaging Het
Nphp4 T C 4: 152,506,485 V313A probably benign Het
Olfm2 T G 9: 20,668,544 probably null Het
Olfr1113 T A 2: 87,213,728 S279T probably benign Het
Olfr248 T C 1: 174,391,375 F102S probably damaging Het
Pcdh15 C T 10: 74,626,788 P1398L probably damaging Het
Pdpr A G 8: 111,114,811 E225G possibly damaging Het
Pigs C A 11: 78,328,769 probably null Het
Pkhd1 T A 1: 20,588,531 T159S probably damaging Het
Plk4 A G 3: 40,813,586 T87A possibly damaging Het
Plxna4 T C 6: 32,215,722 Y768C probably damaging Het
Prl3d3 T A 13: 27,159,081 probably null Het
Pygb T C 2: 150,820,888 probably null Het
Rnf114 T C 2: 167,510,934 I118T possibly damaging Het
Sbno2 A G 10: 80,058,453 L1099P probably benign Het
Scaper T C 9: 55,807,632 K791E probably damaging Het
Serping1 T C 2: 84,771,545 T194A probably damaging Het
Slc12a9 A G 5: 137,321,403 S617P possibly damaging Het
Slk G A 19: 47,636,457 R1039H probably damaging Het
Sntb1 T A 15: 55,792,139 E227V probably benign Het
Sostdc1 C A 12: 36,314,408 P39T probably benign Het
Spred1 C T 2: 117,153,005 R16* probably null Het
Srpk2 A G 5: 23,518,477 I547T probably damaging Het
Stt3a A G 9: 36,759,314 Y54H probably damaging Het
Stt3b A T 9: 115,266,147 L272H probably damaging Het
Syne2 T A 12: 76,108,217 probably null Het
Uso1 A T 5: 92,198,337 E793V possibly damaging Het
Usp15 A T 10: 123,130,987 L476* probably null Het
Vmn1r189 T C 13: 22,102,166 Y167C probably damaging Het
Vmn2r24 A G 6: 123,786,979 T272A possibly damaging Het
Vps13a A T 19: 16,668,690 H1994Q probably damaging Het
Zbtb10 T C 3: 9,265,192 S537P probably damaging Het
Zbtb12 T C 17: 34,895,883 S215P possibly damaging Het
Zfp346 T C 13: 55,113,102 M81T probably benign Het
Zfp800 T C 6: 28,244,513 D151G probably null Het
Other mutations in Col6a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Col6a3 APN 1 90828255 missense probably damaging 1.00
IGL00425:Col6a3 APN 1 90782026 missense unknown
IGL00541:Col6a3 APN 1 90802142 missense possibly damaging 0.83
IGL01063:Col6a3 APN 1 90802332 missense probably damaging 1.00
IGL01094:Col6a3 APN 1 90803933 missense possibly damaging 0.93
IGL01138:Col6a3 APN 1 90807510 missense probably damaging 1.00
IGL01291:Col6a3 APN 1 90802292 missense probably damaging 1.00
IGL01674:Col6a3 APN 1 90802514 missense probably damaging 1.00
IGL01756:Col6a3 APN 1 90779162 missense unknown
IGL01827:Col6a3 APN 1 90802319 missense probably damaging 1.00
IGL01845:Col6a3 APN 1 90796571 missense probably damaging 1.00
IGL01869:Col6a3 APN 1 90773048 missense unknown
IGL01900:Col6a3 APN 1 90795010 critical splice donor site probably null
IGL01925:Col6a3 APN 1 90802236 missense possibly damaging 0.95
IGL02002:Col6a3 APN 1 90782136 splice site probably benign
IGL02115:Col6a3 APN 1 90807651 missense probably damaging 0.99
IGL02302:Col6a3 APN 1 90781760 missense unknown
IGL02313:Col6a3 APN 1 90811606 missense probably damaging 1.00
IGL02458:Col6a3 APN 1 90779197 missense unknown
IGL02821:Col6a3 APN 1 90803878 missense probably damaging 1.00
IGL02828:Col6a3 APN 1 90796559 missense probably damaging 1.00
IGL03112:Col6a3 APN 1 90811520 nonsense probably null
IGL03129:Col6a3 APN 1 90821862 missense probably damaging 1.00
IGL03132:Col6a3 APN 1 90803893 missense probably damaging 1.00
IGL03148:Col6a3 APN 1 90827866 missense probably benign 0.33
IGL03251:Col6a3 APN 1 90810176 missense probably damaging 1.00
ANU05:Col6a3 UTSW 1 90802292 missense probably damaging 1.00
IGL03048:Col6a3 UTSW 1 90810248 missense possibly damaging 0.58
R0020:Col6a3 UTSW 1 90811550 missense probably damaging 0.99
R0020:Col6a3 UTSW 1 90811550 missense probably damaging 0.99
R0033:Col6a3 UTSW 1 90802245 missense probably damaging 1.00
R0033:Col6a3 UTSW 1 90802245 missense probably damaging 1.00
R0105:Col6a3 UTSW 1 90798161 missense possibly damaging 0.65
R0116:Col6a3 UTSW 1 90813551 missense probably damaging 1.00
R0167:Col6a3 UTSW 1 90798173 missense probably damaging 1.00
R0319:Col6a3 UTSW 1 90807704 missense possibly damaging 0.95
R0348:Col6a3 UTSW 1 90828049 missense probably damaging 1.00
R0365:Col6a3 UTSW 1 90788216 missense unknown
R0512:Col6a3 UTSW 1 90821798 intron probably benign
R0564:Col6a3 UTSW 1 90807734 missense probably damaging 1.00
R0635:Col6a3 UTSW 1 90808086 splice site probably null
R0667:Col6a3 UTSW 1 90828101 missense probably damaging 0.98
R0680:Col6a3 UTSW 1 90778981 missense unknown
R0736:Col6a3 UTSW 1 90804089 missense possibly damaging 0.95
R0737:Col6a3 UTSW 1 90828298 missense probably damaging 1.00
R0747:Col6a3 UTSW 1 90802653 missense probably damaging 1.00
R1155:Col6a3 UTSW 1 90794325 missense probably null 1.00
R1169:Col6a3 UTSW 1 90822014 missense possibly damaging 0.67
R1180:Col6a3 UTSW 1 90781855 missense unknown
R1225:Col6a3 UTSW 1 90811516 missense probably damaging 1.00
R1343:Col6a3 UTSW 1 90768347 missense unknown
R1387:Col6a3 UTSW 1 90822416 intron probably benign
R1437:Col6a3 UTSW 1 90801376 missense probably damaging 1.00
R1448:Col6a3 UTSW 1 90781855 missense unknown
R1677:Col6a3 UTSW 1 90821861 missense probably benign 0.14
R1681:Col6a3 UTSW 1 90773502 missense unknown
R1711:Col6a3 UTSW 1 90830213 missense probably damaging 1.00
R1727:Col6a3 UTSW 1 90796574 critical splice acceptor site probably null
R1736:Col6a3 UTSW 1 90779059 missense unknown
R1738:Col6a3 UTSW 1 90816361 missense probably damaging 1.00
R1742:Col6a3 UTSW 1 90813794 missense probably damaging 1.00
R1809:Col6a3 UTSW 1 90827949 missense probably damaging 1.00
R1851:Col6a3 UTSW 1 90807534 missense possibly damaging 0.69
R1852:Col6a3 UTSW 1 90807534 missense possibly damaging 0.69
R1872:Col6a3 UTSW 1 90830214 missense probably damaging 0.96
R1889:Col6a3 UTSW 1 90803711 missense probably benign 0.00
R1895:Col6a3 UTSW 1 90803711 missense probably benign 0.00
R1908:Col6a3 UTSW 1 90811699 missense probably damaging 1.00
R1919:Col6a3 UTSW 1 90822359 missense possibly damaging 0.66
R1973:Col6a3 UTSW 1 90804175 missense probably damaging 1.00
R2083:Col6a3 UTSW 1 90782011 missense unknown
R2121:Col6a3 UTSW 1 90810365 missense probably damaging 1.00
R2197:Col6a3 UTSW 1 90803745 missense probably benign 0.09
R2448:Col6a3 UTSW 1 90813358 missense probably damaging 1.00
R2831:Col6a3 UTSW 1 90803713 missense possibly damaging 0.89
R2877:Col6a3 UTSW 1 90775599 missense unknown
R3052:Col6a3 UTSW 1 90802130 missense possibly damaging 0.71
R3104:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3105:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3106:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3418:Col6a3 UTSW 1 90804091 missense probably benign 0.42
R3419:Col6a3 UTSW 1 90804091 missense probably benign 0.42
R3837:Col6a3 UTSW 1 90780081 missense unknown
R4007:Col6a3 UTSW 1 90802569 missense probably damaging 1.00
R4082:Col6a3 UTSW 1 90821883 missense probably damaging 1.00
R4181:Col6a3 UTSW 1 90807614 missense probably damaging 1.00
R4200:Col6a3 UTSW 1 90801383 missense probably benign 0.28
R4244:Col6a3 UTSW 1 90786639 missense unknown
R4297:Col6a3 UTSW 1 90811378 missense probably damaging 1.00
R4302:Col6a3 UTSW 1 90807614 missense probably damaging 1.00
R4472:Col6a3 UTSW 1 90822014 missense probably benign 0.23
R4600:Col6a3 UTSW 1 90781904 missense unknown
R4683:Col6a3 UTSW 1 90773457 missense unknown
R4788:Col6a3 UTSW 1 90772950 critical splice donor site probably null
R4851:Col6a3 UTSW 1 90779289 missense unknown
R4899:Col6a3 UTSW 1 90802427 missense probably damaging 0.99
R4904:Col6a3 UTSW 1 90801442 missense probably damaging 1.00
R4908:Col6a3 UTSW 1 90807524 missense probably damaging 1.00
R4960:Col6a3 UTSW 1 90804218 missense probably damaging 1.00
R4981:Col6a3 UTSW 1 90778843 missense unknown
R5057:Col6a3 UTSW 1 90816130 missense possibly damaging 0.91
R5062:Col6a3 UTSW 1 90779352 missense unknown
R5105:Col6a3 UTSW 1 90798140 missense possibly damaging 0.81
R5127:Col6a3 UTSW 1 90768345 missense unknown
R5166:Col6a3 UTSW 1 90810608 missense probably damaging 1.00
R5168:Col6a3 UTSW 1 90773639 nonsense probably null
R5196:Col6a3 UTSW 1 90816538 splice site probably null
R5230:Col6a3 UTSW 1 90789054 missense unknown
R5268:Col6a3 UTSW 1 90785243 missense unknown
R5381:Col6a3 UTSW 1 90775612 missense unknown
R5392:Col6a3 UTSW 1 90801295 missense probably benign 0.41
R5445:Col6a3 UTSW 1 90782039 nonsense probably null
R5571:Col6a3 UTSW 1 90788216 missense unknown
R5902:Col6a3 UTSW 1 90802199 unclassified probably null
R5914:Col6a3 UTSW 1 90776200 missense unknown
R5955:Col6a3 UTSW 1 90811441 missense probably damaging 1.00
R5977:Col6a3 UTSW 1 90821849 missense possibly damaging 0.82
R6006:Col6a3 UTSW 1 90768383 missense unknown
R6010:Col6a3 UTSW 1 90773497 missense unknown
R6025:Col6a3 UTSW 1 90828102 missense probably damaging 1.00
R6151:Col6a3 UTSW 1 90813753 missense possibly damaging 0.53
R6154:Col6a3 UTSW 1 90773665 missense unknown
R6181:Col6a3 UTSW 1 90816374 missense possibly damaging 0.95
R6197:Col6a3 UTSW 1 90822341 missense probably damaging 1.00
R6332:Col6a3 UTSW 1 90822233 missense probably damaging 1.00
R6362:Col6a3 UTSW 1 90810563 missense probably damaging 0.99
R6476:Col6a3 UTSW 1 90781812 missense unknown
R6484:Col6a3 UTSW 1 90791923 critical splice donor site probably null
R6701:Col6a3 UTSW 1 90792462 missense probably benign 0.14
R6702:Col6a3 UTSW 1 90779439 missense unknown
R6703:Col6a3 UTSW 1 90779439 missense unknown
R6703:Col6a3 UTSW 1 90792462 missense probably benign 0.14
R6724:Col6a3 UTSW 1 90779152 missense unknown
R6746:Col6a3 UTSW 1 90779045 missense unknown
R6797:Col6a3 UTSW 1 90804088 missense probably damaging 0.99
R6798:Col6a3 UTSW 1 90795009 splice site probably null
R6903:Col6a3 UTSW 1 90794207 missense probably damaging 1.00
R6925:Col6a3 UTSW 1 90816002 missense probably benign 0.00
R6978:Col6a3 UTSW 1 90807470 critical splice donor site probably null
X0024:Col6a3 UTSW 1 90803637 critical splice donor site probably null
X0063:Col6a3 UTSW 1 90803905 missense probably damaging 1.00
X0067:Col6a3 UTSW 1 90811529 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCCCATTTGAAGGAGACTG -3'
(R):5'- CCCTCAGCGGAACTTAAGTC -3'

Sequencing Primer
(F):5'- CTGAAGAAGGATAGTCACGCCTTTG -3'
(R):5'- TCAGCGGAACTTAAGTCTGCGG -3'
Posted On2016-11-09