Incidental Mutation 'R5665:Olfr1113'
ID444312
Institutional Source Beutler Lab
Gene Symbol Olfr1113
Ensembl Gene ENSMUSG00000070857
Gene Nameolfactory receptor 1113
SynonymsMOR264-25, GA_x6K02T2Q125-48697747-48698727
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R5665 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87208970-87214650 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87213728 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 279 (S279T)
Ref Sequence ENSEMBL: ENSMUSP00000150991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079966] [ENSMUST00000215611]
Predicted Effect probably benign
Transcript: ENSMUST00000079966
AA Change: S279T

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000078883
Gene: ENSMUSG00000070857
AA Change: S279T

DomainStartEndE-ValueType
Pfam:7tm_4 46 323 6.7e-53 PFAM
Pfam:7tm_1 56 305 2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215611
AA Change: S279T

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acaca G T 11: 84,245,294 E492* probably null Het
Acp7 T A 7: 28,616,543 K206M probably benign Het
Agbl1 T A 7: 76,589,503 F584I probably damaging Het
Ahi1 A G 10: 21,055,047 I929V possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arhgef40 A G 14: 52,000,900 I1279V possibly damaging Het
Arl14 A C 3: 69,223,038 T173P probably damaging Het
Asap1 A G 15: 64,312,453 S44P probably damaging Het
Btbd7 C A 12: 102,785,197 A1103S probably benign Het
Capn10 T A 1: 92,937,931 probably null Het
Capn7 T C 14: 31,369,802 F719L probably benign Het
Casp7 G A 19: 56,440,982 D267N probably benign Het
Ccdc13 C A 9: 121,814,290 K348N probably damaging Het
Chchd1 T C 14: 20,703,110 F13L probably benign Het
Clcn6 T A 4: 148,014,561 M442L possibly damaging Het
Col6a3 T C 1: 90,827,880 E229G probably benign Het
Cyb5r3 A G 15: 83,154,554 F278S probably damaging Het
Dhx16 C T 17: 35,891,086 Q1002* probably null Het
Dppa4 T C 16: 48,291,015 L121P probably benign Het
Dpyd A G 3: 118,917,092 E383G probably damaging Het
Eif4g3 A G 4: 138,126,589 T489A probably benign Het
Elovl1 G T 4: 118,431,635 V174L probably damaging Het
Elp3 T C 14: 65,551,402 K392E possibly damaging Het
Fancd2os C A 6: 113,598,024 W7L probably damaging Het
Fchsd2 A G 7: 101,110,784 T23A possibly damaging Het
Gabrp C G 11: 33,554,308 A336P possibly damaging Het
Gcm2 T A 13: 41,109,911 Y15F possibly damaging Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Herc1 A G 9: 66,465,435 E3091G probably damaging Het
Homer1 A T 13: 93,356,102 M184L probably benign Het
Izumo1r T C 9: 14,900,849 E117G probably damaging Het
Kcnt1 C T 2: 25,901,909 Q590* probably null Het
Lama1 G T 17: 67,770,987 C1139F probably damaging Het
Med29 C T 7: 28,386,814 A190T probably benign Het
Mgea5 A C 19: 45,776,997 S124A probably benign Het
Muc4 T C 16: 32,750,782 V220A probably benign Het
Mxra8 G T 4: 155,842,921 V388L probably benign Het
Myo5a T C 9: 75,144,181 probably null Het
Myrip A G 9: 120,461,433 Y706C probably damaging Het
Nphp4 T C 4: 152,506,485 V313A probably benign Het
Olfm2 T G 9: 20,668,544 probably null Het
Olfr248 T C 1: 174,391,375 F102S probably damaging Het
Pcdh15 C T 10: 74,626,788 P1398L probably damaging Het
Pdpr A G 8: 111,114,811 E225G possibly damaging Het
Pigs C A 11: 78,328,769 probably null Het
Pkhd1 T A 1: 20,588,531 T159S probably damaging Het
Plk4 A G 3: 40,813,586 T87A possibly damaging Het
Plxna4 T C 6: 32,215,722 Y768C probably damaging Het
Prl3d3 T A 13: 27,159,081 probably null Het
Pygb T C 2: 150,820,888 probably null Het
Rnf114 T C 2: 167,510,934 I118T possibly damaging Het
Sbno2 A G 10: 80,058,453 L1099P probably benign Het
Scaper T C 9: 55,807,632 K791E probably damaging Het
Serping1 T C 2: 84,771,545 T194A probably damaging Het
Slc12a9 A G 5: 137,321,403 S617P possibly damaging Het
Slk G A 19: 47,636,457 R1039H probably damaging Het
Sntb1 T A 15: 55,792,139 E227V probably benign Het
Sostdc1 C A 12: 36,314,408 P39T probably benign Het
Spred1 C T 2: 117,153,005 R16* probably null Het
Srpk2 A G 5: 23,518,477 I547T probably damaging Het
Stt3a A G 9: 36,759,314 Y54H probably damaging Het
Stt3b A T 9: 115,266,147 L272H probably damaging Het
Syne2 T A 12: 76,108,217 probably null Het
Uso1 A T 5: 92,198,337 E793V possibly damaging Het
Usp15 A T 10: 123,130,987 L476* probably null Het
Vmn1r189 T C 13: 22,102,166 Y167C probably damaging Het
Vmn2r24 A G 6: 123,786,979 T272A possibly damaging Het
Vps13a A T 19: 16,668,690 H1994Q probably damaging Het
Zbtb10 T C 3: 9,265,192 S537P probably damaging Het
Zbtb12 T C 17: 34,895,883 S215P possibly damaging Het
Zfp346 T C 13: 55,113,102 M81T probably benign Het
Zfp800 T C 6: 28,244,513 D151G probably null Het
Other mutations in Olfr1113
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02325:Olfr1113 APN 2 87213506 missense probably damaging 0.96
IGL02523:Olfr1113 APN 2 87213320 missense probably benign 0.26
IGL03112:Olfr1113 APN 2 87213600 missense probably damaging 1.00
IGL03137:Olfr1113 APN 2 87213156 missense probably benign 0.42
R0393:Olfr1113 UTSW 2 87213693 missense probably benign
R1758:Olfr1113 UTSW 2 87213414 missense probably benign 0.13
R1920:Olfr1113 UTSW 2 87213377 missense probably benign 0.09
R1992:Olfr1113 UTSW 2 87213244 nonsense probably null
R3742:Olfr1113 UTSW 2 87212996 missense probably benign 0.00
R5615:Olfr1113 UTSW 2 87213739 missense probably benign 0.00
R5749:Olfr1113 UTSW 2 87212943 missense probably benign
R6752:Olfr1113 UTSW 2 87213044 missense probably benign
Z1088:Olfr1113 UTSW 2 87213778 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CAAGTTGGCATGTGGGAACATC -3'
(R):5'- TTTTGACCAGTACAAAGCAAGGAG -3'

Sequencing Primer
(F):5'- GTGGGAACATCTTTGTGAATGAAC -3'
(R):5'- GCAAATCAATGTTAATGAGCTTGCAG -3'
Posted On2016-11-09