Incidental Mutation 'R5665:Zbtb10'
ID444316
Institutional Source Beutler Lab
Gene Symbol Zbtb10
Ensembl Gene ENSMUSG00000069114
Gene Namezinc finger and BTB domain containing 10
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.605) question?
Stock #R5665 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location9250602-9285333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9265192 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 537 (S537P)
Ref Sequence ENSEMBL: ENSMUSP00000119386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000155203]
Predicted Effect probably damaging
Transcript: ENSMUST00000155203
AA Change: S537P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119386
Gene: ENSMUSG00000069114
AA Change: S537P

DomainStartEndE-ValueType
low complexity region 15 32 N/A INTRINSIC
low complexity region 38 54 N/A INTRINSIC
low complexity region 75 82 N/A INTRINSIC
low complexity region 96 111 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
low complexity region 180 222 N/A INTRINSIC
ZnF_TTF 239 321 7.92e-2 SMART
BTB 357 456 4.02e-20 SMART
internal_repeat_1 648 671 2.82e-12 PROSPERO
internal_repeat_1 672 695 2.82e-12 PROSPERO
ZnF_C2H2 714 736 6.78e-3 SMART
ZnF_C2H2 742 764 2.09e-3 SMART
low complexity region 765 777 N/A INTRINSIC
low complexity region 823 842 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acaca G T 11: 84,245,294 E492* probably null Het
Acp7 T A 7: 28,616,543 K206M probably benign Het
Agbl1 T A 7: 76,589,503 F584I probably damaging Het
Ahi1 A G 10: 21,055,047 I929V possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arhgef40 A G 14: 52,000,900 I1279V possibly damaging Het
Arl14 A C 3: 69,223,038 T173P probably damaging Het
Asap1 A G 15: 64,312,453 S44P probably damaging Het
Btbd7 C A 12: 102,785,197 A1103S probably benign Het
Capn10 T A 1: 92,937,931 probably null Het
Capn7 T C 14: 31,369,802 F719L probably benign Het
Casp7 G A 19: 56,440,982 D267N probably benign Het
Ccdc13 C A 9: 121,814,290 K348N probably damaging Het
Chchd1 T C 14: 20,703,110 F13L probably benign Het
Clcn6 T A 4: 148,014,561 M442L possibly damaging Het
Col6a3 T C 1: 90,827,880 E229G probably benign Het
Cyb5r3 A G 15: 83,154,554 F278S probably damaging Het
Dhx16 C T 17: 35,891,086 Q1002* probably null Het
Dppa4 T C 16: 48,291,015 L121P probably benign Het
Dpyd A G 3: 118,917,092 E383G probably damaging Het
Eif4g3 A G 4: 138,126,589 T489A probably benign Het
Elovl1 G T 4: 118,431,635 V174L probably damaging Het
Elp3 T C 14: 65,551,402 K392E possibly damaging Het
Fancd2os C A 6: 113,598,024 W7L probably damaging Het
Fchsd2 A G 7: 101,110,784 T23A possibly damaging Het
Gabrp C G 11: 33,554,308 A336P possibly damaging Het
Gcm2 T A 13: 41,109,911 Y15F possibly damaging Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Herc1 A G 9: 66,465,435 E3091G probably damaging Het
Homer1 A T 13: 93,356,102 M184L probably benign Het
Izumo1r T C 9: 14,900,849 E117G probably damaging Het
Kcnt1 C T 2: 25,901,909 Q590* probably null Het
Lama1 G T 17: 67,770,987 C1139F probably damaging Het
Med29 C T 7: 28,386,814 A190T probably benign Het
Mgea5 A C 19: 45,776,997 S124A probably benign Het
Muc4 T C 16: 32,750,782 V220A probably benign Het
Mxra8 G T 4: 155,842,921 V388L probably benign Het
Myo5a T C 9: 75,144,181 probably null Het
Myrip A G 9: 120,461,433 Y706C probably damaging Het
Nphp4 T C 4: 152,506,485 V313A probably benign Het
Olfm2 T G 9: 20,668,544 probably null Het
Olfr1113 T A 2: 87,213,728 S279T probably benign Het
Olfr248 T C 1: 174,391,375 F102S probably damaging Het
Pcdh15 C T 10: 74,626,788 P1398L probably damaging Het
Pdpr A G 8: 111,114,811 E225G possibly damaging Het
Pigs C A 11: 78,328,769 probably null Het
Pkhd1 T A 1: 20,588,531 T159S probably damaging Het
Plk4 A G 3: 40,813,586 T87A possibly damaging Het
Plxna4 T C 6: 32,215,722 Y768C probably damaging Het
Prl3d3 T A 13: 27,159,081 probably null Het
Pygb T C 2: 150,820,888 probably null Het
Rnf114 T C 2: 167,510,934 I118T possibly damaging Het
Sbno2 A G 10: 80,058,453 L1099P probably benign Het
Scaper T C 9: 55,807,632 K791E probably damaging Het
Serping1 T C 2: 84,771,545 T194A probably damaging Het
Slc12a9 A G 5: 137,321,403 S617P possibly damaging Het
Slk G A 19: 47,636,457 R1039H probably damaging Het
Sntb1 T A 15: 55,792,139 E227V probably benign Het
Sostdc1 C A 12: 36,314,408 P39T probably benign Het
Spred1 C T 2: 117,153,005 R16* probably null Het
Srpk2 A G 5: 23,518,477 I547T probably damaging Het
Stt3a A G 9: 36,759,314 Y54H probably damaging Het
Stt3b A T 9: 115,266,147 L272H probably damaging Het
Syne2 T A 12: 76,108,217 probably null Het
Uso1 A T 5: 92,198,337 E793V possibly damaging Het
Usp15 A T 10: 123,130,987 L476* probably null Het
Vmn1r189 T C 13: 22,102,166 Y167C probably damaging Het
Vmn2r24 A G 6: 123,786,979 T272A possibly damaging Het
Vps13a A T 19: 16,668,690 H1994Q probably damaging Het
Zbtb12 T C 17: 34,895,883 S215P possibly damaging Het
Zfp346 T C 13: 55,113,102 M81T probably benign Het
Zfp800 T C 6: 28,244,513 D151G probably null Het
Other mutations in Zbtb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02174:Zbtb10 APN 3 9251812 missense probably damaging 0.96
IGL02207:Zbtb10 APN 3 9280465 critical splice donor site probably null
IGL02499:Zbtb10 APN 3 9251740 missense probably damaging 1.00
IGL02506:Zbtb10 APN 3 9265237 missense probably damaging 0.99
IGL03294:Zbtb10 APN 3 9280987 missense probably benign 0.18
R0510:Zbtb10 UTSW 3 9264668 missense probably damaging 1.00
R1859:Zbtb10 UTSW 3 9280386 missense possibly damaging 0.47
R2342:Zbtb10 UTSW 3 9265195 missense possibly damaging 0.60
R3407:Zbtb10 UTSW 3 9264866 missense probably damaging 1.00
R4161:Zbtb10 UTSW 3 9280296 missense probably damaging 1.00
R4301:Zbtb10 UTSW 3 9265160 missense probably damaging 0.96
R4698:Zbtb10 UTSW 3 9264550 missense possibly damaging 0.87
R5184:Zbtb10 UTSW 3 9264671 missense probably damaging 0.99
R5443:Zbtb10 UTSW 3 9280048 missense probably benign
R5744:Zbtb10 UTSW 3 9264563 missense probably damaging 1.00
R5862:Zbtb10 UTSW 3 9265216 missense probably damaging 0.98
R5909:Zbtb10 UTSW 3 9280049 missense probably benign 0.14
R6547:Zbtb10 UTSW 3 9251703 missense probably benign 0.38
R6612:Zbtb10 UTSW 3 9252065 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GTTGTGGACTATAACAATAGGAAGCC -3'
(R):5'- TTCTTCTGGGTAGGCAGCAG -3'

Sequencing Primer
(F):5'- CAGTTAGCAGGGACAGCCTG -3'
(R):5'- AGGGGGCTGCATCACTGAG -3'
Posted On2016-11-09