Incidental Mutation 'R5665:Plk4'
ID444317
Institutional Source Beutler Lab
Gene Symbol Plk4
Ensembl Gene ENSMUSG00000025758
Gene Namepolo like kinase 4
SynonymsStk18, Sak
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5665 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location40800019-40816883 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40813586 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 87 (T87A)
Ref Sequence ENSEMBL: ENSMUSP00000145201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026858] [ENSMUST00000026859] [ENSMUST00000167556] [ENSMUST00000203295] [ENSMUST00000203895] [ENSMUST00000204032]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026858
AA Change: T855A

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026858
Gene: ENSMUSG00000025758
AA Change: T855A

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 554 774 6e-41 PDB
low complexity region 820 831 N/A INTRINSIC
Pfam:POLO_box 849 910 7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026859
SMART Domains Protein: ENSMUSP00000026859
Gene: ENSMUSG00000025759

DomainStartEndE-ValueType
Pfam:Sugar_tr 31 235 3.6e-13 PFAM
Pfam:MFS_1 43 387 4.2e-31 PFAM
transmembrane domain 417 439 N/A INTRINSIC
transmembrane domain 452 474 N/A INTRINSIC
transmembrane domain 484 503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167556
AA Change: T852A

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126945
Gene: ENSMUSG00000025758
AA Change: T852A

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 551 771 6e-41 PDB
low complexity region 817 828 N/A INTRINSIC
Pfam:POLO_box 844 908 1.6e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171538
AA Change: T87A

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130134
Gene: ENSMUSG00000025758
AA Change: T87A

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
Pfam:POLO_box 79 143 3.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203295
AA Change: T828A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000145277
Gene: ENSMUSG00000025758
AA Change: T828A

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 554 747 3e-32 PDB
low complexity region 793 804 N/A INTRINSIC
Pfam:POLO_box 822 883 6.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203895
SMART Domains Protein: ENSMUSP00000145455
Gene: ENSMUSG00000025758

DomainStartEndE-ValueType
STYKc 12 143 3.5e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000204032
AA Change: T87A

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000145201
Gene: ENSMUSG00000025758
AA Change: T87A

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
Pfam:POLO_box 81 142 2.5e-12 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the polo family of serine/threonine protein kinases. The protein localizes to the nucleolus during G2, to centrosomes during G2/M, and to the cleavage furrow during cytokinesis. It is required for progression through mitosis, cell survival, and embryonic development. The mouse genome contains a pseudogene similar to this gene. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for disruptions of this gene die before birth. Development is arrested around E7.5. Mice heterozygous for an ENU-induced allele or gene trap alele exhibit male hypogonadism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acaca G T 11: 84,245,294 E492* probably null Het
Acp7 T A 7: 28,616,543 K206M probably benign Het
Agbl1 T A 7: 76,589,503 F584I probably damaging Het
Ahi1 A G 10: 21,055,047 I929V possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arhgef40 A G 14: 52,000,900 I1279V possibly damaging Het
Arl14 A C 3: 69,223,038 T173P probably damaging Het
Asap1 A G 15: 64,312,453 S44P probably damaging Het
Btbd7 C A 12: 102,785,197 A1103S probably benign Het
Capn10 T A 1: 92,937,931 probably null Het
Capn7 T C 14: 31,369,802 F719L probably benign Het
Casp7 G A 19: 56,440,982 D267N probably benign Het
Ccdc13 C A 9: 121,814,290 K348N probably damaging Het
Chchd1 T C 14: 20,703,110 F13L probably benign Het
Clcn6 T A 4: 148,014,561 M442L possibly damaging Het
Col6a3 T C 1: 90,827,880 E229G probably benign Het
Cyb5r3 A G 15: 83,154,554 F278S probably damaging Het
Dhx16 C T 17: 35,891,086 Q1002* probably null Het
Dppa4 T C 16: 48,291,015 L121P probably benign Het
Dpyd A G 3: 118,917,092 E383G probably damaging Het
Eif4g3 A G 4: 138,126,589 T489A probably benign Het
Elovl1 G T 4: 118,431,635 V174L probably damaging Het
Elp3 T C 14: 65,551,402 K392E possibly damaging Het
Fancd2os C A 6: 113,598,024 W7L probably damaging Het
Fchsd2 A G 7: 101,110,784 T23A possibly damaging Het
Gabrp C G 11: 33,554,308 A336P possibly damaging Het
Gcm2 T A 13: 41,109,911 Y15F possibly damaging Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Herc1 A G 9: 66,465,435 E3091G probably damaging Het
Homer1 A T 13: 93,356,102 M184L probably benign Het
Izumo1r T C 9: 14,900,849 E117G probably damaging Het
Kcnt1 C T 2: 25,901,909 Q590* probably null Het
Lama1 G T 17: 67,770,987 C1139F probably damaging Het
Med29 C T 7: 28,386,814 A190T probably benign Het
Mgea5 A C 19: 45,776,997 S124A probably benign Het
Muc4 T C 16: 32,750,782 V220A probably benign Het
Mxra8 G T 4: 155,842,921 V388L probably benign Het
Myo5a T C 9: 75,144,181 probably null Het
Myrip A G 9: 120,461,433 Y706C probably damaging Het
Nphp4 T C 4: 152,506,485 V313A probably benign Het
Olfm2 T G 9: 20,668,544 probably null Het
Olfr1113 T A 2: 87,213,728 S279T probably benign Het
Olfr248 T C 1: 174,391,375 F102S probably damaging Het
Pcdh15 C T 10: 74,626,788 P1398L probably damaging Het
Pdpr A G 8: 111,114,811 E225G possibly damaging Het
Pigs C A 11: 78,328,769 probably null Het
Pkhd1 T A 1: 20,588,531 T159S probably damaging Het
Plxna4 T C 6: 32,215,722 Y768C probably damaging Het
Prl3d3 T A 13: 27,159,081 probably null Het
Pygb T C 2: 150,820,888 probably null Het
Rnf114 T C 2: 167,510,934 I118T possibly damaging Het
Sbno2 A G 10: 80,058,453 L1099P probably benign Het
Scaper T C 9: 55,807,632 K791E probably damaging Het
Serping1 T C 2: 84,771,545 T194A probably damaging Het
Slc12a9 A G 5: 137,321,403 S617P possibly damaging Het
Slk G A 19: 47,636,457 R1039H probably damaging Het
Sntb1 T A 15: 55,792,139 E227V probably benign Het
Sostdc1 C A 12: 36,314,408 P39T probably benign Het
Spred1 C T 2: 117,153,005 R16* probably null Het
Srpk2 A G 5: 23,518,477 I547T probably damaging Het
Stt3a A G 9: 36,759,314 Y54H probably damaging Het
Stt3b A T 9: 115,266,147 L272H probably damaging Het
Syne2 T A 12: 76,108,217 probably null Het
Uso1 A T 5: 92,198,337 E793V possibly damaging Het
Usp15 A T 10: 123,130,987 L476* probably null Het
Vmn1r189 T C 13: 22,102,166 Y167C probably damaging Het
Vmn2r24 A G 6: 123,786,979 T272A possibly damaging Het
Vps13a A T 19: 16,668,690 H1994Q probably damaging Het
Zbtb10 T C 3: 9,265,192 S537P probably damaging Het
Zbtb12 T C 17: 34,895,883 S215P possibly damaging Het
Zfp346 T C 13: 55,113,102 M81T probably benign Het
Zfp800 T C 6: 28,244,513 D151G probably null Het
Other mutations in Plk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Plk4 APN 3 40801789 missense probably damaging 1.00
IGL01730:Plk4 APN 3 40805850 missense probably benign 0.00
IGL01906:Plk4 APN 3 40810381 missense probably null 0.01
IGL02021:Plk4 APN 3 40810708 missense probably damaging 0.97
IGL02718:Plk4 APN 3 40815021 missense probably damaging 1.00
IGL03287:Plk4 APN 3 40805118 missense probably benign 0.11
R0058:Plk4 UTSW 3 40805872 missense probably benign
R0058:Plk4 UTSW 3 40805872 missense probably benign
R0312:Plk4 UTSW 3 40813547 missense probably damaging 0.97
R0387:Plk4 UTSW 3 40812884 splice site probably benign
R0411:Plk4 UTSW 3 40811219 unclassified probably benign
R0480:Plk4 UTSW 3 40805640 missense probably benign 0.15
R1170:Plk4 UTSW 3 40801847 missense probably damaging 1.00
R1268:Plk4 UTSW 3 40811369 missense probably damaging 1.00
R1529:Plk4 UTSW 3 40806536 missense probably benign 0.09
R1987:Plk4 UTSW 3 40805817 missense possibly damaging 0.60
R1988:Plk4 UTSW 3 40805817 missense possibly damaging 0.60
R2050:Plk4 UTSW 3 40810380 missense probably benign
R4409:Plk4 UTSW 3 40806549 missense probably damaging 0.98
R4727:Plk4 UTSW 3 40805154 missense probably benign 0.00
R4765:Plk4 UTSW 3 40802022 missense probably damaging 1.00
R4772:Plk4 UTSW 3 40805190 missense probably damaging 1.00
R5022:Plk4 UTSW 3 40802077 splice site probably null
R5363:Plk4 UTSW 3 40801984 missense possibly damaging 0.71
R5651:Plk4 UTSW 3 40813505 missense probably benign 0.00
R5724:Plk4 UTSW 3 40801046 missense probably damaging 1.00
R6391:Plk4 UTSW 3 40808973 missense probably benign 0.05
R6694:Plk4 UTSW 3 40801828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTCGCCAACTTTAGCTAC -3'
(R):5'- GACATCATTCTCTATTCTGCAAAACCC -3'

Sequencing Primer
(F):5'- CAGAAGACATGATTTGGCCTTCC -3'
(R):5'- TTCTGCAAAACCCTTATCATGAC -3'
Posted On2016-11-09