Incidental Mutation 'R5665:Nphp4'
ID444326
Institutional Source Beutler Lab
Gene Symbol Nphp4
Ensembl Gene ENSMUSG00000039577
Gene Namenephronophthisis 4 (juvenile) homolog (human)
Synonymsnmf192, 4930564O18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R5665 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location152476706-152563183 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152506485 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 313 (V313A)
Ref Sequence ENSEMBL: ENSMUSP00000080128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056567] [ENSMUST00000081393]
Predicted Effect probably benign
Transcript: ENSMUST00000056567
AA Change: V313A

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000049920
Gene: ENSMUSG00000039577
AA Change: V313A

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 507 530 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081393
AA Change: V313A

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000080128
Gene: ENSMUSG00000039577
AA Change: V313A

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 507 530 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142027
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in renal tubular development and function. This protein interacts with nephrocystin, and belongs to a multifunctional complex that is localized to actin- and microtubule-based structures. Mutations in this gene are associated with nephronophthisis type 4, a renal disease, and with Senior-Loken syndrome type 4, a combination of nephronophthisis and retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mutant mice have a mottled retina with photoreceptor degeneration and male infertility associated with oligozoospermia and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acaca G T 11: 84,245,294 E492* probably null Het
Acp7 T A 7: 28,616,543 K206M probably benign Het
Agbl1 T A 7: 76,589,503 F584I probably damaging Het
Ahi1 A G 10: 21,055,047 I929V possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arhgef40 A G 14: 52,000,900 I1279V possibly damaging Het
Arl14 A C 3: 69,223,038 T173P probably damaging Het
Asap1 A G 15: 64,312,453 S44P probably damaging Het
Btbd7 C A 12: 102,785,197 A1103S probably benign Het
Capn10 T A 1: 92,937,931 probably null Het
Capn7 T C 14: 31,369,802 F719L probably benign Het
Casp7 G A 19: 56,440,982 D267N probably benign Het
Ccdc13 C A 9: 121,814,290 K348N probably damaging Het
Chchd1 T C 14: 20,703,110 F13L probably benign Het
Clcn6 T A 4: 148,014,561 M442L possibly damaging Het
Col6a3 T C 1: 90,827,880 E229G probably benign Het
Cyb5r3 A G 15: 83,154,554 F278S probably damaging Het
Dhx16 C T 17: 35,891,086 Q1002* probably null Het
Dppa4 T C 16: 48,291,015 L121P probably benign Het
Dpyd A G 3: 118,917,092 E383G probably damaging Het
Eif4g3 A G 4: 138,126,589 T489A probably benign Het
Elovl1 G T 4: 118,431,635 V174L probably damaging Het
Elp3 T C 14: 65,551,402 K392E possibly damaging Het
Fancd2os C A 6: 113,598,024 W7L probably damaging Het
Fchsd2 A G 7: 101,110,784 T23A possibly damaging Het
Gabrp C G 11: 33,554,308 A336P possibly damaging Het
Gcm2 T A 13: 41,109,911 Y15F possibly damaging Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Herc1 A G 9: 66,465,435 E3091G probably damaging Het
Homer1 A T 13: 93,356,102 M184L probably benign Het
Izumo1r T C 9: 14,900,849 E117G probably damaging Het
Kcnt1 C T 2: 25,901,909 Q590* probably null Het
Lama1 G T 17: 67,770,987 C1139F probably damaging Het
Med29 C T 7: 28,386,814 A190T probably benign Het
Mgea5 A C 19: 45,776,997 S124A probably benign Het
Muc4 T C 16: 32,750,782 V220A probably benign Het
Mxra8 G T 4: 155,842,921 V388L probably benign Het
Myo5a T C 9: 75,144,181 probably null Het
Myrip A G 9: 120,461,433 Y706C probably damaging Het
Olfm2 T G 9: 20,668,544 probably null Het
Olfr1113 T A 2: 87,213,728 S279T probably benign Het
Olfr248 T C 1: 174,391,375 F102S probably damaging Het
Pcdh15 C T 10: 74,626,788 P1398L probably damaging Het
Pdpr A G 8: 111,114,811 E225G possibly damaging Het
Pigs C A 11: 78,328,769 probably null Het
Pkhd1 T A 1: 20,588,531 T159S probably damaging Het
Plk4 A G 3: 40,813,586 T87A possibly damaging Het
Plxna4 T C 6: 32,215,722 Y768C probably damaging Het
Prl3d3 T A 13: 27,159,081 probably null Het
Pygb T C 2: 150,820,888 probably null Het
Rnf114 T C 2: 167,510,934 I118T possibly damaging Het
Sbno2 A G 10: 80,058,453 L1099P probably benign Het
Scaper T C 9: 55,807,632 K791E probably damaging Het
Serping1 T C 2: 84,771,545 T194A probably damaging Het
Slc12a9 A G 5: 137,321,403 S617P possibly damaging Het
Slk G A 19: 47,636,457 R1039H probably damaging Het
Sntb1 T A 15: 55,792,139 E227V probably benign Het
Sostdc1 C A 12: 36,314,408 P39T probably benign Het
Spred1 C T 2: 117,153,005 R16* probably null Het
Srpk2 A G 5: 23,518,477 I547T probably damaging Het
Stt3a A G 9: 36,759,314 Y54H probably damaging Het
Stt3b A T 9: 115,266,147 L272H probably damaging Het
Syne2 T A 12: 76,108,217 probably null Het
Uso1 A T 5: 92,198,337 E793V possibly damaging Het
Usp15 A T 10: 123,130,987 L476* probably null Het
Vmn1r189 T C 13: 22,102,166 Y167C probably damaging Het
Vmn2r24 A G 6: 123,786,979 T272A possibly damaging Het
Vps13a A T 19: 16,668,690 H1994Q probably damaging Het
Zbtb10 T C 3: 9,265,192 S537P probably damaging Het
Zbtb12 T C 17: 34,895,883 S215P possibly damaging Het
Zfp346 T C 13: 55,113,102 M81T probably benign Het
Zfp800 T C 6: 28,244,513 D151G probably null Het
Other mutations in Nphp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Nphp4 APN 4 152537309 splice site probably benign
IGL00963:Nphp4 APN 4 152537861 missense probably benign 0.01
IGL01571:Nphp4 APN 4 152556382 missense probably benign 0.21
IGL01707:Nphp4 APN 4 152538983 missense probably benign 0.00
IGL01837:Nphp4 APN 4 152488881 missense probably damaging 0.96
IGL02341:Nphp4 APN 4 152555469
IGL02558:Nphp4 APN 4 152555531 missense probably damaging 1.00
IGL02563:Nphp4 APN 4 152556220 missense probably benign 0.00
IGL02712:Nphp4 APN 4 152556275 missense probably damaging 1.00
IGL03023:Nphp4 APN 4 152524235 splice site probably null
R0280:Nphp4 UTSW 4 152551936 splice site probably benign
R0317:Nphp4 UTSW 4 152551931 critical splice donor site probably null
R0410:Nphp4 UTSW 4 152557046 missense probably benign
R0433:Nphp4 UTSW 4 152518172 missense probably benign 0.00
R0706:Nphp4 UTSW 4 152555617 missense probably damaging 0.98
R0785:Nphp4 UTSW 4 152562109 missense possibly damaging 0.58
R0890:Nphp4 UTSW 4 152498220 missense possibly damaging 0.93
R0930:Nphp4 UTSW 4 152538055 missense probably benign 0.01
R1202:Nphp4 UTSW 4 152488729 splice site probably null
R1203:Nphp4 UTSW 4 152488832 missense probably damaging 0.96
R1366:Nphp4 UTSW 4 152502926 missense probably damaging 0.96
R1452:Nphp4 UTSW 4 152547018 missense probably damaging 0.99
R1598:Nphp4 UTSW 4 152562090 missense probably benign 0.00
R1699:Nphp4 UTSW 4 152496664 missense probably damaging 0.99
R2007:Nphp4 UTSW 4 152554654 missense probably damaging 0.97
R2082:Nphp4 UTSW 4 152559364 missense probably benign 0.38
R2264:Nphp4 UTSW 4 152503008 splice site probably benign
R2280:Nphp4 UTSW 4 152557043 missense possibly damaging 0.95
R2281:Nphp4 UTSW 4 152557043 missense possibly damaging 0.95
R2926:Nphp4 UTSW 4 152518139 missense probably damaging 0.99
R3764:Nphp4 UTSW 4 152538017 splice site probably benign
R4084:Nphp4 UTSW 4 152488791 missense probably damaging 1.00
R4091:Nphp4 UTSW 4 152547018 missense probably damaging 0.97
R4240:Nphp4 UTSW 4 152555684 missense probably benign 0.07
R4701:Nphp4 UTSW 4 152496659 missense probably damaging 1.00
R4778:Nphp4 UTSW 4 152556291 missense probably benign 0.44
R4783:Nphp4 UTSW 4 152554546 missense probably benign 0.00
R4784:Nphp4 UTSW 4 152554546 missense probably benign 0.00
R4974:Nphp4 UTSW 4 152537793 missense probably damaging 1.00
R5053:Nphp4 UTSW 4 152544462 splice site probably null
R5117:Nphp4 UTSW 4 152524232 splice site probably null
R5128:Nphp4 UTSW 4 152502991 missense probably benign 0.01
R5890:Nphp4 UTSW 4 152547079 missense probably benign 0.44
R6171:Nphp4 UTSW 4 152544449 missense probably damaging 0.99
R6601:Nphp4 UTSW 4 152503007 splice site probably null
R6772:Nphp4 UTSW 4 152544406 missense probably benign 0.07
R6806:Nphp4 UTSW 4 152538101 missense probably benign 0.02
T0970:Nphp4 UTSW 4 152556379 missense probably damaging 1.00
X0058:Nphp4 UTSW 4 152559707 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTCCCAGACATGCAGAACTC -3'
(R):5'- TGTCCATCCCCGAGGTTTATG -3'

Sequencing Primer
(F):5'- GACATGCAGAACTCATCTCTCTAC -3'
(R):5'- TTGACGGAAAAGCACAGCTC -3'
Posted On2016-11-09