Incidental Mutation 'R5665:Vmn2r24'
ID444334
Institutional Source Beutler Lab
Gene Symbol Vmn2r24
Ensembl Gene ENSMUSG00000072780
Gene Namevomeronasal 2, receptor 24
SynonymsEG243628
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R5665 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location123778971-123816280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123786979 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 272 (T272A)
Ref Sequence ENSEMBL: ENSMUSP00000074602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075095]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075095
AA Change: T272A

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074602
Gene: ENSMUSG00000072780
AA Change: T272A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 469 1.6e-32 PFAM
Pfam:NCD3G 518 571 1.1e-22 PFAM
Pfam:7tm_3 602 839 1.1e-54 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acaca G T 11: 84,245,294 E492* probably null Het
Acp7 T A 7: 28,616,543 K206M probably benign Het
Agbl1 T A 7: 76,589,503 F584I probably damaging Het
Ahi1 A G 10: 21,055,047 I929V possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arhgef40 A G 14: 52,000,900 I1279V possibly damaging Het
Arl14 A C 3: 69,223,038 T173P probably damaging Het
Asap1 A G 15: 64,312,453 S44P probably damaging Het
Btbd7 C A 12: 102,785,197 A1103S probably benign Het
Capn10 T A 1: 92,937,931 probably null Het
Capn7 T C 14: 31,369,802 F719L probably benign Het
Casp7 G A 19: 56,440,982 D267N probably benign Het
Ccdc13 C A 9: 121,814,290 K348N probably damaging Het
Chchd1 T C 14: 20,703,110 F13L probably benign Het
Clcn6 T A 4: 148,014,561 M442L possibly damaging Het
Col6a3 T C 1: 90,827,880 E229G probably benign Het
Cyb5r3 A G 15: 83,154,554 F278S probably damaging Het
Dhx16 C T 17: 35,891,086 Q1002* probably null Het
Dppa4 T C 16: 48,291,015 L121P probably benign Het
Dpyd A G 3: 118,917,092 E383G probably damaging Het
Eif4g3 A G 4: 138,126,589 T489A probably benign Het
Elovl1 G T 4: 118,431,635 V174L probably damaging Het
Elp3 T C 14: 65,551,402 K392E possibly damaging Het
Fancd2os C A 6: 113,598,024 W7L probably damaging Het
Fchsd2 A G 7: 101,110,784 T23A possibly damaging Het
Gabrp C G 11: 33,554,308 A336P possibly damaging Het
Gcm2 T A 13: 41,109,911 Y15F possibly damaging Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Herc1 A G 9: 66,465,435 E3091G probably damaging Het
Homer1 A T 13: 93,356,102 M184L probably benign Het
Izumo1r T C 9: 14,900,849 E117G probably damaging Het
Kcnt1 C T 2: 25,901,909 Q590* probably null Het
Lama1 G T 17: 67,770,987 C1139F probably damaging Het
Med29 C T 7: 28,386,814 A190T probably benign Het
Mgea5 A C 19: 45,776,997 S124A probably benign Het
Muc4 T C 16: 32,750,782 V220A probably benign Het
Mxra8 G T 4: 155,842,921 V388L probably benign Het
Myo5a T C 9: 75,144,181 probably null Het
Myrip A G 9: 120,461,433 Y706C probably damaging Het
Nphp4 T C 4: 152,506,485 V313A probably benign Het
Olfm2 T G 9: 20,668,544 probably null Het
Olfr1113 T A 2: 87,213,728 S279T probably benign Het
Olfr248 T C 1: 174,391,375 F102S probably damaging Het
Pcdh15 C T 10: 74,626,788 P1398L probably damaging Het
Pdpr A G 8: 111,114,811 E225G possibly damaging Het
Pigs C A 11: 78,328,769 probably null Het
Pkhd1 T A 1: 20,588,531 T159S probably damaging Het
Plk4 A G 3: 40,813,586 T87A possibly damaging Het
Plxna4 T C 6: 32,215,722 Y768C probably damaging Het
Prl3d3 T A 13: 27,159,081 probably null Het
Pygb T C 2: 150,820,888 probably null Het
Rnf114 T C 2: 167,510,934 I118T possibly damaging Het
Sbno2 A G 10: 80,058,453 L1099P probably benign Het
Scaper T C 9: 55,807,632 K791E probably damaging Het
Serping1 T C 2: 84,771,545 T194A probably damaging Het
Slc12a9 A G 5: 137,321,403 S617P possibly damaging Het
Slk G A 19: 47,636,457 R1039H probably damaging Het
Sntb1 T A 15: 55,792,139 E227V probably benign Het
Sostdc1 C A 12: 36,314,408 P39T probably benign Het
Spred1 C T 2: 117,153,005 R16* probably null Het
Srpk2 A G 5: 23,518,477 I547T probably damaging Het
Stt3a A G 9: 36,759,314 Y54H probably damaging Het
Stt3b A T 9: 115,266,147 L272H probably damaging Het
Syne2 T A 12: 76,108,217 probably null Het
Uso1 A T 5: 92,198,337 E793V possibly damaging Het
Usp15 A T 10: 123,130,987 L476* probably null Het
Vmn1r189 T C 13: 22,102,166 Y167C probably damaging Het
Vps13a A T 19: 16,668,690 H1994Q probably damaging Het
Zbtb10 T C 3: 9,265,192 S537P probably damaging Het
Zbtb12 T C 17: 34,895,883 S215P possibly damaging Het
Zfp346 T C 13: 55,113,102 M81T probably benign Het
Zfp800 T C 6: 28,244,513 D151G probably null Het
Other mutations in Vmn2r24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Vmn2r24 APN 6 123815637 missense probably damaging 1.00
IGL01382:Vmn2r24 APN 6 123786979 missense possibly damaging 0.62
IGL01592:Vmn2r24 APN 6 123787486 missense probably benign 0.30
IGL01754:Vmn2r24 APN 6 123804161 missense probably damaging 1.00
IGL01939:Vmn2r24 APN 6 123787445 missense probably benign
IGL02140:Vmn2r24 APN 6 123780672 missense probably damaging 0.98
IGL02272:Vmn2r24 APN 6 123786884 missense possibly damaging 0.94
IGL02568:Vmn2r24 APN 6 123815853 missense probably benign 0.36
IGL02748:Vmn2r24 APN 6 123816098 missense possibly damaging 0.90
IGL03022:Vmn2r24 APN 6 123779008 missense probably damaging 0.99
IGL03343:Vmn2r24 APN 6 123816111 missense probably damaging 1.00
R0357:Vmn2r24 UTSW 6 123815410 frame shift probably null
R0453:Vmn2r24 UTSW 6 123780391 critical splice acceptor site probably null
R0538:Vmn2r24 UTSW 6 123816053 missense probably benign 0.32
R0607:Vmn2r24 UTSW 6 123786934 missense probably benign
R1381:Vmn2r24 UTSW 6 123786733 missense probably damaging 1.00
R1589:Vmn2r24 UTSW 6 123806520 splice site probably benign
R1848:Vmn2r24 UTSW 6 123816224 missense probably damaging 1.00
R2035:Vmn2r24 UTSW 6 123816060 missense probably damaging 1.00
R2077:Vmn2r24 UTSW 6 123815399 missense probably damaging 1.00
R2122:Vmn2r24 UTSW 6 123815394 missense possibly damaging 0.81
R2145:Vmn2r24 UTSW 6 123779013 missense probably benign
R2483:Vmn2r24 UTSW 6 123816038 missense probably damaging 1.00
R2512:Vmn2r24 UTSW 6 123787026 missense probably benign 0.01
R3001:Vmn2r24 UTSW 6 123804272 missense probably benign 0.00
R3002:Vmn2r24 UTSW 6 123804272 missense probably benign 0.00
R3236:Vmn2r24 UTSW 6 123779025 nonsense probably null
R3623:Vmn2r24 UTSW 6 123816038 missense probably damaging 1.00
R3624:Vmn2r24 UTSW 6 123816038 missense probably damaging 1.00
R3835:Vmn2r24 UTSW 6 123787453 missense probably benign 0.33
R4074:Vmn2r24 UTSW 6 123787415 missense possibly damaging 0.92
R4075:Vmn2r24 UTSW 6 123787415 missense possibly damaging 0.92
R4812:Vmn2r24 UTSW 6 123779185 missense probably benign 0.00
R4825:Vmn2r24 UTSW 6 123815780 missense probably benign 0.02
R5351:Vmn2r24 UTSW 6 123816264 missense possibly damaging 0.80
R5790:Vmn2r24 UTSW 6 123815540 missense probably benign
R5808:Vmn2r24 UTSW 6 123815638 nonsense probably null
R5879:Vmn2r24 UTSW 6 123787267 missense possibly damaging 0.89
R5923:Vmn2r24 UTSW 6 123815792 missense probably damaging 0.96
R5969:Vmn2r24 UTSW 6 123779022 missense probably benign 0.00
R6050:Vmn2r24 UTSW 6 123815732 missense probably damaging 1.00
R6171:Vmn2r24 UTSW 6 123787246 missense probably damaging 0.98
R6174:Vmn2r24 UTSW 6 123816277 missense probably benign 0.00
R6356:Vmn2r24 UTSW 6 123806409 missense possibly damaging 0.93
R6562:Vmn2r24 UTSW 6 123780427 missense probably benign 0.01
R6563:Vmn2r24 UTSW 6 123804178 missense possibly damaging 0.86
R6584:Vmn2r24 UTSW 6 123815805 missense possibly damaging 0.53
R6630:Vmn2r24 UTSW 6 123787022 missense probably benign 0.00
R6803:Vmn2r24 UTSW 6 123779001 missense possibly damaging 0.64
R6864:Vmn2r24 UTSW 6 123779158 missense possibly damaging 0.89
X0023:Vmn2r24 UTSW 6 123787400 missense probably damaging 0.99
Z1088:Vmn2r24 UTSW 6 123804196 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCAGGGAATTATTCAACTGCTGC -3'
(R):5'- CCAGAATTTCATCCATGTGAAACG -3'

Sequencing Primer
(F):5'- AACTGCTGCTATACTTCACTTGGG -3'
(R):5'- GTGAAACGAAAATAATAATCCTCCAC -3'
Posted On2016-11-09