Incidental Mutation 'R5665:Pdpr'
ID444342
Institutional Source Beutler Lab
Gene Symbol Pdpr
Ensembl Gene ENSMUSG00000033624
Gene Namepyruvate dehydrogenase phosphatase regulatory subunit
Synonyms4930402E16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R5665 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location111094630-111137074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111114811 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 225 (E225G)
Ref Sequence ENSEMBL: ENSMUSP00000046639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039333] [ENSMUST00000135302] [ENSMUST00000144377]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039333
AA Change: E225G

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046639
Gene: ENSMUSG00000033624
AA Change: E225G

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:FAD_binding_2 43 235 8.3e-8 PFAM
Pfam:DAO 43 401 1.5e-58 PFAM
Pfam:FAO_M 404 459 1.2e-19 PFAM
Pfam:GCV_T 461 738 4.7e-71 PFAM
Pfam:GCV_T_C 746 854 1.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135302
SMART Domains Protein: ENSMUSP00000117570
Gene: ENSMUSG00000033624

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:DAO 43 145 4.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144377
AA Change: E225G

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121325
Gene: ENSMUSG00000033624
AA Change: E225G

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:FAD_binding_2 43 236 2.4e-8 PFAM
Pfam:DAO 43 401 3.3e-72 PFAM
Pfam:GCV_T 522 667 1.4e-29 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pyruvate dehydrogenase complex (PDC) catalyzes the oxidative decarboxylation of pyruvate and links glycolysis to the tricarboxylic acid cycle and fatty acid synthesis. The dephosphorylation and reactivation of PDC is catalyzed by pyruvate dehydrogenase phosphatase (PDP). The dimeric PDP has a catalytic subunit and a regulatory subunit. This gene encodes the FAD-containing regulatory subunit of PDP. The encoded protein acts to decrease the sensitivity of the PDP catalytic subunit to magnesium ions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acaca G T 11: 84,245,294 E492* probably null Het
Acp7 T A 7: 28,616,543 K206M probably benign Het
Agbl1 T A 7: 76,589,503 F584I probably damaging Het
Ahi1 A G 10: 21,055,047 I929V possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arhgef40 A G 14: 52,000,900 I1279V possibly damaging Het
Arl14 A C 3: 69,223,038 T173P probably damaging Het
Asap1 A G 15: 64,312,453 S44P probably damaging Het
Btbd7 C A 12: 102,785,197 A1103S probably benign Het
Capn10 T A 1: 92,937,931 probably null Het
Capn7 T C 14: 31,369,802 F719L probably benign Het
Casp7 G A 19: 56,440,982 D267N probably benign Het
Ccdc13 C A 9: 121,814,290 K348N probably damaging Het
Chchd1 T C 14: 20,703,110 F13L probably benign Het
Clcn6 T A 4: 148,014,561 M442L possibly damaging Het
Col6a3 T C 1: 90,827,880 E229G probably benign Het
Cyb5r3 A G 15: 83,154,554 F278S probably damaging Het
Dhx16 C T 17: 35,891,086 Q1002* probably null Het
Dppa4 T C 16: 48,291,015 L121P probably benign Het
Dpyd A G 3: 118,917,092 E383G probably damaging Het
Eif4g3 A G 4: 138,126,589 T489A probably benign Het
Elovl1 G T 4: 118,431,635 V174L probably damaging Het
Elp3 T C 14: 65,551,402 K392E possibly damaging Het
Fancd2os C A 6: 113,598,024 W7L probably damaging Het
Fchsd2 A G 7: 101,110,784 T23A possibly damaging Het
Gabrp C G 11: 33,554,308 A336P possibly damaging Het
Gcm2 T A 13: 41,109,911 Y15F possibly damaging Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Herc1 A G 9: 66,465,435 E3091G probably damaging Het
Homer1 A T 13: 93,356,102 M184L probably benign Het
Izumo1r T C 9: 14,900,849 E117G probably damaging Het
Kcnt1 C T 2: 25,901,909 Q590* probably null Het
Lama1 G T 17: 67,770,987 C1139F probably damaging Het
Med29 C T 7: 28,386,814 A190T probably benign Het
Mgea5 A C 19: 45,776,997 S124A probably benign Het
Muc4 T C 16: 32,750,782 V220A probably benign Het
Mxra8 G T 4: 155,842,921 V388L probably benign Het
Myo5a T C 9: 75,144,181 probably null Het
Myrip A G 9: 120,461,433 Y706C probably damaging Het
Nphp4 T C 4: 152,506,485 V313A probably benign Het
Olfm2 T G 9: 20,668,544 probably null Het
Olfr1113 T A 2: 87,213,728 S279T probably benign Het
Olfr248 T C 1: 174,391,375 F102S probably damaging Het
Pcdh15 C T 10: 74,626,788 P1398L probably damaging Het
Pigs C A 11: 78,328,769 probably null Het
Pkhd1 T A 1: 20,588,531 T159S probably damaging Het
Plk4 A G 3: 40,813,586 T87A possibly damaging Het
Plxna4 T C 6: 32,215,722 Y768C probably damaging Het
Prl3d3 T A 13: 27,159,081 probably null Het
Pygb T C 2: 150,820,888 probably null Het
Rnf114 T C 2: 167,510,934 I118T possibly damaging Het
Sbno2 A G 10: 80,058,453 L1099P probably benign Het
Scaper T C 9: 55,807,632 K791E probably damaging Het
Serping1 T C 2: 84,771,545 T194A probably damaging Het
Slc12a9 A G 5: 137,321,403 S617P possibly damaging Het
Slk G A 19: 47,636,457 R1039H probably damaging Het
Sntb1 T A 15: 55,792,139 E227V probably benign Het
Sostdc1 C A 12: 36,314,408 P39T probably benign Het
Spred1 C T 2: 117,153,005 R16* probably null Het
Srpk2 A G 5: 23,518,477 I547T probably damaging Het
Stt3a A G 9: 36,759,314 Y54H probably damaging Het
Stt3b A T 9: 115,266,147 L272H probably damaging Het
Syne2 T A 12: 76,108,217 probably null Het
Uso1 A T 5: 92,198,337 E793V possibly damaging Het
Usp15 A T 10: 123,130,987 L476* probably null Het
Vmn1r189 T C 13: 22,102,166 Y167C probably damaging Het
Vmn2r24 A G 6: 123,786,979 T272A possibly damaging Het
Vps13a A T 19: 16,668,690 H1994Q probably damaging Het
Zbtb10 T C 3: 9,265,192 S537P probably damaging Het
Zbtb12 T C 17: 34,895,883 S215P possibly damaging Het
Zfp346 T C 13: 55,113,102 M81T probably benign Het
Zfp800 T C 6: 28,244,513 D151G probably null Het
Other mutations in Pdpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Pdpr APN 8 111102072 missense possibly damaging 0.69
IGL01116:Pdpr APN 8 111112710 missense possibly damaging 0.84
IGL01353:Pdpr APN 8 111121278 splice site probably null
IGL01681:Pdpr APN 8 111132936 missense probably damaging 1.00
IGL01785:Pdpr APN 8 111129656 missense probably damaging 0.98
IGL02115:Pdpr APN 8 111103998 missense probably damaging 1.00
IGL02292:Pdpr APN 8 111125680 missense probably damaging 1.00
IGL02749:Pdpr APN 8 111118090 missense probably benign 0.01
IGL03296:Pdpr APN 8 111114798 missense probably damaging 1.00
R0730:Pdpr UTSW 8 111125755 critical splice donor site probably null
R1510:Pdpr UTSW 8 111124475 splice site probably benign
R1837:Pdpr UTSW 8 111134734 missense probably damaging 1.00
R1838:Pdpr UTSW 8 111134734 missense probably damaging 1.00
R2144:Pdpr UTSW 8 111118036 missense probably damaging 0.97
R4214:Pdpr UTSW 8 111129580 intron probably benign
R4812:Pdpr UTSW 8 111116717 missense probably benign 0.00
R4863:Pdpr UTSW 8 111101951 missense probably benign 0.01
R4998:Pdpr UTSW 8 111114768 missense probably damaging 1.00
R5579:Pdpr UTSW 8 111123816 missense probably damaging 1.00
R5739:Pdpr UTSW 8 111134620 missense possibly damaging 0.78
R6675:Pdpr UTSW 8 111101900 nonsense probably null
R6785:Pdpr UTSW 8 111124611 missense probably benign 0.00
R6889:Pdpr UTSW 8 111124613 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTCTTAACCAGTAAGCCTTC -3'
(R):5'- AGCTCTGGATTACCCACTCC -3'

Sequencing Primer
(F):5'- ACCAGGTTGGCTTAGAACTC -3'
(R):5'- GCTCTGGATTACCCACTCCAAATAAG -3'
Posted On2016-11-09