Incidental Mutation 'R5665:Gabrp'
ID444359
Institutional Source Beutler Lab
Gene Symbol Gabrp
Ensembl Gene ENSMUSG00000020159
Gene Namegamma-aminobutyric acid (GABA) A receptor, pi
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5665 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location33550781-33578959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 33554308 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Proline at position 336 (A336P)
Ref Sequence ENSEMBL: ENSMUSP00000020366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020366]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020366
AA Change: A336P

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020366
Gene: ENSMUSG00000020159
AA Change: A336P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Neur_chan_LBD 40 242 1.3e-49 PFAM
Pfam:Neur_chan_memb 249 353 5.2e-23 PFAM
transmembrane domain 420 437 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. The subunit encoded by this gene is expressed in several non-neuronal tissues including the uterus and ovaries. This subunit can assemble with known GABA A receptor subunits, and the presence of this subunit alters the sensitivity of recombinant receptors to modulatory agents such as pregnanolone. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acaca G T 11: 84,245,294 E492* probably null Het
Acp7 T A 7: 28,616,543 K206M probably benign Het
Agbl1 T A 7: 76,589,503 F584I probably damaging Het
Ahi1 A G 10: 21,055,047 I929V possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arhgef40 A G 14: 52,000,900 I1279V possibly damaging Het
Arl14 A C 3: 69,223,038 T173P probably damaging Het
Asap1 A G 15: 64,312,453 S44P probably damaging Het
Btbd7 C A 12: 102,785,197 A1103S probably benign Het
Capn10 T A 1: 92,937,931 probably null Het
Capn7 T C 14: 31,369,802 F719L probably benign Het
Casp7 G A 19: 56,440,982 D267N probably benign Het
Ccdc13 C A 9: 121,814,290 K348N probably damaging Het
Chchd1 T C 14: 20,703,110 F13L probably benign Het
Clcn6 T A 4: 148,014,561 M442L possibly damaging Het
Col6a3 T C 1: 90,827,880 E229G probably benign Het
Cyb5r3 A G 15: 83,154,554 F278S probably damaging Het
Dhx16 C T 17: 35,891,086 Q1002* probably null Het
Dppa4 T C 16: 48,291,015 L121P probably benign Het
Dpyd A G 3: 118,917,092 E383G probably damaging Het
Eif4g3 A G 4: 138,126,589 T489A probably benign Het
Elovl1 G T 4: 118,431,635 V174L probably damaging Het
Elp3 T C 14: 65,551,402 K392E possibly damaging Het
Fancd2os C A 6: 113,598,024 W7L probably damaging Het
Fchsd2 A G 7: 101,110,784 T23A possibly damaging Het
Gcm2 T A 13: 41,109,911 Y15F possibly damaging Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Herc1 A G 9: 66,465,435 E3091G probably damaging Het
Homer1 A T 13: 93,356,102 M184L probably benign Het
Izumo1r T C 9: 14,900,849 E117G probably damaging Het
Kcnt1 C T 2: 25,901,909 Q590* probably null Het
Lama1 G T 17: 67,770,987 C1139F probably damaging Het
Med29 C T 7: 28,386,814 A190T probably benign Het
Mgea5 A C 19: 45,776,997 S124A probably benign Het
Muc4 T C 16: 32,750,782 V220A probably benign Het
Mxra8 G T 4: 155,842,921 V388L probably benign Het
Myo5a T C 9: 75,144,181 probably null Het
Myrip A G 9: 120,461,433 Y706C probably damaging Het
Nphp4 T C 4: 152,506,485 V313A probably benign Het
Olfm2 T G 9: 20,668,544 probably null Het
Olfr1113 T A 2: 87,213,728 S279T probably benign Het
Olfr248 T C 1: 174,391,375 F102S probably damaging Het
Pcdh15 C T 10: 74,626,788 P1398L probably damaging Het
Pdpr A G 8: 111,114,811 E225G possibly damaging Het
Pigs C A 11: 78,328,769 probably null Het
Pkhd1 T A 1: 20,588,531 T159S probably damaging Het
Plk4 A G 3: 40,813,586 T87A possibly damaging Het
Plxna4 T C 6: 32,215,722 Y768C probably damaging Het
Prl3d3 T A 13: 27,159,081 probably null Het
Pygb T C 2: 150,820,888 probably null Het
Rnf114 T C 2: 167,510,934 I118T possibly damaging Het
Sbno2 A G 10: 80,058,453 L1099P probably benign Het
Scaper T C 9: 55,807,632 K791E probably damaging Het
Serping1 T C 2: 84,771,545 T194A probably damaging Het
Slc12a9 A G 5: 137,321,403 S617P possibly damaging Het
Slk G A 19: 47,636,457 R1039H probably damaging Het
Sntb1 T A 15: 55,792,139 E227V probably benign Het
Sostdc1 C A 12: 36,314,408 P39T probably benign Het
Spred1 C T 2: 117,153,005 R16* probably null Het
Srpk2 A G 5: 23,518,477 I547T probably damaging Het
Stt3a A G 9: 36,759,314 Y54H probably damaging Het
Stt3b A T 9: 115,266,147 L272H probably damaging Het
Syne2 T A 12: 76,108,217 probably null Het
Uso1 A T 5: 92,198,337 E793V possibly damaging Het
Usp15 A T 10: 123,130,987 L476* probably null Het
Vmn1r189 T C 13: 22,102,166 Y167C probably damaging Het
Vmn2r24 A G 6: 123,786,979 T272A possibly damaging Het
Vps13a A T 19: 16,668,690 H1994Q probably damaging Het
Zbtb10 T C 3: 9,265,192 S537P probably damaging Het
Zbtb12 T C 17: 34,895,883 S215P possibly damaging Het
Zfp346 T C 13: 55,113,102 M81T probably benign Het
Zfp800 T C 6: 28,244,513 D151G probably null Het
Other mutations in Gabrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Gabrp APN 11 33552644 missense possibly damaging 0.91
IGL01299:Gabrp APN 11 33554476 missense probably damaging 1.00
IGL01305:Gabrp APN 11 33555055 missense probably damaging 1.00
IGL01686:Gabrp APN 11 33552826 nonsense probably null
IGL01729:Gabrp APN 11 33552689 missense probably damaging 1.00
IGL03031:Gabrp APN 11 33554980 missense probably damaging 1.00
IGL03172:Gabrp APN 11 33554388 missense probably damaging 1.00
IGL03280:Gabrp APN 11 33552616 missense probably benign 0.12
ANU22:Gabrp UTSW 11 33555055 missense probably damaging 1.00
R0265:Gabrp UTSW 11 33552614 missense probably damaging 1.00
R0326:Gabrp UTSW 11 33554362 missense probably damaging 0.99
R1744:Gabrp UTSW 11 33572462 missense probably benign 0.03
R4174:Gabrp UTSW 11 33568092 missense probably damaging 1.00
R5043:Gabrp UTSW 11 33568072 missense probably benign 0.00
R5213:Gabrp UTSW 11 33567211 critical splice donor site probably null
R5290:Gabrp UTSW 11 33567310 missense probably damaging 0.99
R6698:Gabrp UTSW 11 33557017 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATAAATTTGGGTCAAGGGGCAC -3'
(R):5'- AGCCAGATGATCGAGGTTGG -3'

Sequencing Primer
(F):5'- GGCACCATGACTTCCAAATGTG -3'
(R):5'- TGTTCATGGAACACCAGCATG -3'
Posted On2016-11-09